Incidental Mutation 'R1541:Svs2'
ID171707
Institutional Source Beutler Lab
Gene Symbol Svs2
Ensembl Gene ENSMUSG00000040132
Gene Nameseminal vesicle secretory protein 2
Synonymssemenoclotin, SVS II
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164235929-164238466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164237009 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 326 (R326Q)
Ref Sequence ENSEMBL: ENSMUSP00000104999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044953] [ENSMUST00000109374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044953
AA Change: R326Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042389
Gene: ENSMUSG00000040132
AA Change: R326Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109374
AA Change: R326Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104999
Gene: ENSMUSG00000040132
AA Change: R326Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display severely reduced fertility with premature acrosome reaction, absence of copulatory plug formation and intrauterine death of sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Svs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs2 APN 2 164237042 missense possibly damaging 0.86
IGL01722:Svs2 APN 2 164237526 missense possibly damaging 0.71
IGL03189:Svs2 APN 2 164237112 missense possibly damaging 0.73
R1276:Svs2 UTSW 2 164237248 missense possibly damaging 0.95
R1590:Svs2 UTSW 2 164237658 missense possibly damaging 0.86
R3946:Svs2 UTSW 2 164237127 missense probably benign 0.01
R3965:Svs2 UTSW 2 164237742 missense possibly damaging 0.53
R4075:Svs2 UTSW 2 164237318 missense probably benign 0.01
R4632:Svs2 UTSW 2 164237747 missense probably benign 0.40
R4732:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4733:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4839:Svs2 UTSW 2 164236886 missense probably benign 0.40
R5706:Svs2 UTSW 2 164237669 missense possibly damaging 0.53
R6936:Svs2 UTSW 2 164237628 missense possibly damaging 0.86
R7052:Svs2 UTSW 2 164238206 missense unknown
R7836:Svs2 UTSW 2 164237580 missense possibly damaging 0.86
R8035:Svs2 UTSW 2 164237133 missense probably benign 0.18
R8100:Svs2 UTSW 2 164237792 missense probably benign 0.08
R8187:Svs2 UTSW 2 164237772 missense possibly damaging 0.88
R8310:Svs2 UTSW 2 164238171 missense probably damaging 1.00
R8312:Svs2 UTSW 2 164238171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATAGTGGACCCAGGACTTCTTC -3'
(R):5'- CCAGCCTTTGGACAAGTGAAATCCC -3'

Sequencing Primer
(F):5'- GTGGACCCAGGACTTCTTCATATAC -3'
(R):5'- CAAGTGAAGTCCAGTGTGTCC -3'
Posted On2014-04-13