Incidental Mutation 'R1541:Ythdf1'
ID171709
Institutional Source Beutler Lab
Gene Symbol Ythdf1
Ensembl Gene ENSMUSG00000038848
Gene NameYTH domain family 1
Synonyms
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1541 (G1)
Quality Score202
Status Not validated
Chromosome2
Chromosomal Location180904377-180920949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 180919143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 35 (S35A)
Ref Sequence ENSEMBL: ENSMUSP00000116665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037299] [ENSMUST00000108876] [ENSMUST00000124666]
Predicted Effect probably damaging
Transcript: ENSMUST00000037299
AA Change: S42A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037808
Gene: ENSMUSG00000038848
AA Change: S42A

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Pfam:YTH 388 526 4.2e-51 PFAM
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108876
AA Change: S69A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104504
Gene: ENSMUSG00000038848
AA Change: S69A

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 306 353 N/A INTRINSIC
Pfam:YTH 416 551 1.9e-46 PFAM
low complexity region 567 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124666
AA Change: S35A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116665
Gene: ENSMUSG00000038848
AA Change: S35A

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Ythdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Ythdf1 APN 2 180911693 missense probably damaging 0.99
IGL03066:Ythdf1 APN 2 180911546 missense probably damaging 1.00
Agitated UTSW 2 180919133 critical splice donor site probably null
R1258:Ythdf1 UTSW 2 180911310 missense probably benign 0.05
R1738:Ythdf1 UTSW 2 180911492 missense probably benign 0.00
R1856:Ythdf1 UTSW 2 180910970 missense probably damaging 1.00
R2169:Ythdf1 UTSW 2 180912114 missense probably damaging 1.00
R4606:Ythdf1 UTSW 2 180912182 missense probably damaging 0.97
R5296:Ythdf1 UTSW 2 180912188 missense probably damaging 0.98
R6250:Ythdf1 UTSW 2 180911100 missense probably damaging 1.00
R6254:Ythdf1 UTSW 2 180911150 missense probably damaging 1.00
R6702:Ythdf1 UTSW 2 180919133 critical splice donor site probably null
R7102:Ythdf1 UTSW 2 180911522 missense probably damaging 1.00
R7409:Ythdf1 UTSW 2 180911993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGCACTGTCCAGAACTTACC -3'
(R):5'- AACTGGCTCCAAGTCTGGTTGC -3'

Sequencing Primer
(F):5'- ATGCTAAAAGTCTGCCTGTACC -3'
(R):5'- AGAGTGTGCCCATTTTGAAAG -3'
Posted On2014-04-13