Mutagenetix > Incidental Mutations

Incidental Mutation 'R1541:Plag1'

171714

Institutional Source

Beutler Lab

Gene Symbol

Plag1

Ensembl Gene

ENSMUSG00000003282

Gene Name

pleiomorphic adenoma gene 1

Synonyms

MMRRC Submission

039580-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.813) question?

Stock #

R1541 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3900996-3938423 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3904085 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 369 (S369P)

Ref Sequence

ENSEMBL: ENSMUSP00000003369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]

Predicted Effect

probably benign
Transcript: ENSMUST00000003369
AA Change: S369P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: S369P

Domain	Start	End	E-Value	Type
ZnF_C2H2	34	56	2.2e-2	SMART
ZnF_C2H2	62	86	1.6e-4	SMART
ZnF_C2H2	92	114	1.89e-1	SMART
ZnF_C2H2	121	143	5.99e-4	SMART
ZnF_C2H2	150	172	2.86e-1	SMART
ZnF_C2H2	185	207	1.03e-2	SMART
ZnF_C2H2	213	236	8.94e-3	SMART
low complexity region	364	379	N/A	INTRINSIC
low complexity region	396	411	N/A	INTRINSIC
low complexity region	471	491	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137439

Predicted Effect

probably benign
Transcript: ENSMUST00000151543

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	A	G	14: 103,049,333	D24G	probably damaging	Het
Angptl2	G	A	2: 33,246,165	R454H	probably benign	Het
Atat1	T	A	17: 35,904,331	N181I	probably damaging	Het
Atp6v0d2	A	C	4: 19,910,645	F82V	probably damaging	Het
BC100530	T	A	16: 36,367,501	M1L	probably damaging	Het
Casp3	A	G	8: 46,634,334	I105M	probably benign	Het
Ccdc33	T	A	9: 58,117,466	D159V	probably damaging	Het
Cd163	A	C	6: 124,327,961	D1099A	probably benign	Het
Cep128	A	T	12: 91,348,781	S110R	probably damaging	Het
Cfap43	A	T	19: 47,763,852		probably null	Het
Cfap58	T	C	19: 47,983,530	I633T	probably damaging	Het
Clvs1	A	G	4: 9,281,814	H86R	probably benign	Het
Comt	T	C	16: 18,411,815	K48R	probably benign	Het
Crip2	T	C	12: 113,144,966	V64A	possibly damaging	Het
Cwf19l2	T	A	9: 3,456,760	S698T	probably damaging	Het
Dis3l	T	C	9: 64,307,489	I933V	probably benign	Het
Dnah8	C	A	17: 30,747,247	N2470K	probably damaging	Het
Dstn	T	C	2: 143,938,488	V36A	possibly damaging	Het
Dtx1	T	A	5: 120,710,346		probably benign	Het
Dzip1	G	A	14: 118,879,478	S782L	probably damaging	Het
Ece1	T	A	4: 137,948,660		probably null	Het
Erich1	A	G	8: 14,030,688	I277T	probably damaging	Het
Fam26d	T	C	10: 34,041,663	H264R	probably benign	Het
Gbp4	T	A	5: 105,118,409	M589L	probably benign	Het
Gm15448	T	C	7: 3,816,989	D525G	probably damaging	Het
Gm9733	T	A	3: 15,320,684	T53S	possibly damaging	Het
Grip1	T	C	10: 120,000,543	I440T	probably damaging	Het
Helz	C	T	11: 107,670,048	S1311L	probably benign	Het
Herc2	A	T	7: 56,135,657	I1552F	probably damaging	Het
Kif13a	T	C	13: 46,809,213	T459A	probably benign	Het
Knop1	G	A	7: 118,855,786		probably benign	Het
Llgl2	C	A	11: 115,853,121	T758K	probably benign	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc71	T	C	3: 87,741,841	D340G	possibly damaging	Het
Luzp1	A	G	4: 136,543,325	D953G	probably damaging	Het
Mst1r	T	C	9: 107,917,363	V1247A	probably damaging	Het
Ncoa4	A	T	14: 32,176,888	K555M	probably damaging	Het
Ncoa6	A	T	2: 155,415,304	L773Q	probably benign	Het
Ndc1	C	T	4: 107,371,288	Q70*	probably null	Het
Nfe2l3	C	T	6: 51,457,605	L382F	probably damaging	Het
Nlrp4b	C	A	7: 10,725,052	T399N	possibly damaging	Het
Nsmce2	T	A	15: 59,601,385	D250E	probably damaging	Het
Nudt14	A	T	12: 112,934,928	L184Q	probably damaging	Het
Ogdhl	G	A	14: 32,340,667	R570H	possibly damaging	Het
Olfr477	T	C	7: 107,990,841	F159L	probably benign	Het
Papd5	T	C	8: 88,245,599	V222A	probably damaging	Het
Ranbp2	A	T	10: 58,483,094	T2476S	possibly damaging	Het
Rnmt	T	C	18: 68,307,782	L172P	probably damaging	Het
Sec24a	T	A	11: 51,743,796	H101L	probably benign	Het
Srm	A	G	4: 148,593,424	D173G	probably damaging	Het
Srp54b	A	G	12: 55,256,059	D380G	probably benign	Het
Svs2	C	T	2: 164,237,009	R326Q	possibly damaging	Het
Tfap2b	C	T	1: 19,234,070	T350M	probably damaging	Het
Tie1	A	T	4: 118,483,873	C304S	probably damaging	Het
Tsc2	G	T	17: 24,631,976	T36N	probably damaging	Het
Wdhd1	A	T	14: 47,268,192	Y274*	probably null	Het
Wdr37	T	C	13: 8,820,538	T373A	probably benign	Het
Xirp2	A	T	2: 67,512,290	N1625I	possibly damaging	Het
Ythdf1	A	C	2: 180,919,143	S35A	probably damaging	Het
Zfp462	A	G	4: 55,008,928	N298S	possibly damaging	Het
Zfp541	T	A	7: 16,078,512	D363E	probably benign	Het
Zgpat	A	G	2: 181,378,865	D277G	probably benign	Het
Znfx1	A	T	2: 167,056,190	N271K	probably damaging	Het

Other mutations in Plag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00775:Plag1	APN	4	3904055	missense	probably damaging	0.99
IGL01775:Plag1	APN	4	3904513	missense	probably damaging	1.00
IGL02738:Plag1	APN	4	3903812	nonsense	probably null
Rehab	UTSW	4	3904546	missense	probably damaging	1.00
scrawny	UTSW	4	3905463	nonsense	probably null
PIT4378001:Plag1	UTSW	4	3905492	missense	probably benign	0.16
R0217:Plag1	UTSW	4	3904379	missense	probably benign	0.05
R0359:Plag1	UTSW	4	3904546	missense	probably damaging	1.00
R0554:Plag1	UTSW	4	3904546	missense	probably damaging	1.00
R0892:Plag1	UTSW	4	3904532	nonsense	probably null
R1964:Plag1	UTSW	4	3903956	missense	probably benign
R2011:Plag1	UTSW	4	3904889	missense	probably damaging	1.00
R2012:Plag1	UTSW	4	3904870	missense	probably damaging	1.00
R2126:Plag1	UTSW	4	3904169	missense	possibly damaging	0.50
R3982:Plag1	UTSW	4	3904055	missense	probably damaging	0.97
R4285:Plag1	UTSW	4	3905654	missense	probably benign	0.13
R5244:Plag1	UTSW	4	3903887	missense	probably benign	0.02
R5289:Plag1	UTSW	4	3905545	missense	probably damaging	1.00
R5386:Plag1	UTSW	4	3904075	missense	probably benign
R5428:Plag1	UTSW	4	3905538	missense	possibly damaging	0.94
R5608:Plag1	UTSW	4	3905463	nonsense	probably null
R5755:Plag1	UTSW	4	3904492	missense	possibly damaging	0.94
R6036:Plag1	UTSW	4	3904618	missense	possibly damaging	0.94
R6036:Plag1	UTSW	4	3904618	missense	possibly damaging	0.94
R6080:Plag1	UTSW	4	3903815	missense	probably benign
R6296:Plag1	UTSW	4	3904499	missense	probably damaging	1.00
R7038:Plag1	UTSW	4	3904676	missense	probably damaging	1.00
R7116:Plag1	UTSW	4	3904812	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGAGTGCAGAGAACTTAGACCCAC -3'
(R):5'- CCTTTGGGAATGACATGCCCCATAG -3'

Sequencing Primer
(F):5'- GAACTTAGACCCACAGTGTTTGC -3'
(R):5'- ATGCCCCATAGATATGGATGCTG -3'

Posted On

2014-04-13