Incidental Mutation 'R1541:Plag1'
ID171714
Institutional Source Beutler Lab
Gene Symbol Plag1
Ensembl Gene ENSMUSG00000003282
Gene Namepleiomorphic adenoma gene 1
Synonyms
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location3900996-3938423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3904085 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 369 (S369P)
Ref Sequence ENSEMBL: ENSMUSP00000003369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]
Predicted Effect probably benign
Transcript: ENSMUST00000003369
AA Change: S369P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: S369P

DomainStartEndE-ValueType
ZnF_C2H2 34 56 2.2e-2 SMART
ZnF_C2H2 62 86 1.6e-4 SMART
ZnF_C2H2 92 114 1.89e-1 SMART
ZnF_C2H2 121 143 5.99e-4 SMART
ZnF_C2H2 150 172 2.86e-1 SMART
ZnF_C2H2 185 207 1.03e-2 SMART
ZnF_C2H2 213 236 8.94e-3 SMART
low complexity region 364 379 N/A INTRINSIC
low complexity region 396 411 N/A INTRINSIC
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137439
Predicted Effect probably benign
Transcript: ENSMUST00000151543
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Plag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Plag1 APN 4 3904055 missense probably damaging 0.99
IGL01775:Plag1 APN 4 3904513 missense probably damaging 1.00
IGL02738:Plag1 APN 4 3903812 nonsense probably null
Rehab UTSW 4 3904546 missense probably damaging 1.00
scrawny UTSW 4 3905463 nonsense probably null
PIT4378001:Plag1 UTSW 4 3905492 missense probably benign 0.16
R0217:Plag1 UTSW 4 3904379 missense probably benign 0.05
R0359:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0554:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0892:Plag1 UTSW 4 3904532 nonsense probably null
R1964:Plag1 UTSW 4 3903956 missense probably benign
R2011:Plag1 UTSW 4 3904889 missense probably damaging 1.00
R2012:Plag1 UTSW 4 3904870 missense probably damaging 1.00
R2126:Plag1 UTSW 4 3904169 missense possibly damaging 0.50
R3982:Plag1 UTSW 4 3904055 missense probably damaging 0.97
R4285:Plag1 UTSW 4 3905654 missense probably benign 0.13
R5244:Plag1 UTSW 4 3903887 missense probably benign 0.02
R5289:Plag1 UTSW 4 3905545 missense probably damaging 1.00
R5386:Plag1 UTSW 4 3904075 missense probably benign
R5428:Plag1 UTSW 4 3905538 missense possibly damaging 0.94
R5608:Plag1 UTSW 4 3905463 nonsense probably null
R5755:Plag1 UTSW 4 3904492 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6080:Plag1 UTSW 4 3903815 missense probably benign
R6296:Plag1 UTSW 4 3904499 missense probably damaging 1.00
R7038:Plag1 UTSW 4 3904676 missense probably damaging 1.00
R7116:Plag1 UTSW 4 3904812 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGAGTGCAGAGAACTTAGACCCAC -3'
(R):5'- CCTTTGGGAATGACATGCCCCATAG -3'

Sequencing Primer
(F):5'- GAACTTAGACCCACAGTGTTTGC -3'
(R):5'- ATGCCCCATAGATATGGATGCTG -3'
Posted On2014-04-13