Incidental Mutation 'R1541:Pira13'
ID 171728
Institutional Source Beutler Lab
Gene Symbol Pira13
Ensembl Gene ENSMUSG00000074419
Gene Name paired-Ig-like receptor A13
Synonyms Gm15448, ENSMUSG00000074419
MMRRC Submission 039580-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R1541 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 3819780-3828686 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3819988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 525 (D525G)
Ref Sequence ENSEMBL: ENSMUSP00000104260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
AlphaFold F6PZL4
Predicted Effect probably benign
Transcript: ENSMUST00000094911
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108619
AA Change: D626G
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: D626G

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108620
AA Change: D525G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: D525G

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: D643G
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: D643G

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189095
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,286,769 (GRCm39) D24G probably damaging Het
Angptl2 G A 2: 33,136,177 (GRCm39) R454H probably benign Het
Atat1 T A 17: 36,215,223 (GRCm39) N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 (GRCm39) F82V probably damaging Het
Calhm4 T C 10: 33,917,659 (GRCm39) H264R probably benign Het
Casp3 A G 8: 47,087,369 (GRCm39) I105M probably benign Het
Ccdc33 T A 9: 58,024,749 (GRCm39) D159V probably damaging Het
Cd163 A C 6: 124,304,920 (GRCm39) D1099A probably benign Het
Cep128 A T 12: 91,315,555 (GRCm39) S110R probably damaging Het
Cfap43 A T 19: 47,752,291 (GRCm39) probably null Het
Cfap58 T C 19: 47,971,969 (GRCm39) I633T probably damaging Het
Clvs1 A G 4: 9,281,814 (GRCm39) H86R probably benign Het
Comt T C 16: 18,230,565 (GRCm39) K48R probably benign Het
Crip2 T C 12: 113,108,586 (GRCm39) V64A possibly damaging Het
Cstdc5 T A 16: 36,187,863 (GRCm39) M1L probably damaging Het
Cwf19l2 T A 9: 3,456,760 (GRCm39) S698T probably damaging Het
Dis3l T C 9: 64,214,771 (GRCm39) I933V probably benign Het
Dnah8 C A 17: 30,966,221 (GRCm39) N2470K probably damaging Het
Dstn T C 2: 143,780,408 (GRCm39) V36A possibly damaging Het
Dtx1 T A 5: 120,848,411 (GRCm39) probably benign Het
Dzip1 G A 14: 119,116,890 (GRCm39) S782L probably damaging Het
Ece1 T A 4: 137,675,971 (GRCm39) probably null Het
Erich1 A G 8: 14,080,688 (GRCm39) I277T probably damaging Het
Gbp4 T A 5: 105,266,275 (GRCm39) M589L probably benign Het
Grip1 T C 10: 119,836,448 (GRCm39) I440T probably damaging Het
Helz C T 11: 107,560,874 (GRCm39) S1311L probably benign Het
Herc2 A T 7: 55,785,405 (GRCm39) I1552F probably damaging Het
Kif13a T C 13: 46,962,689 (GRCm39) T459A probably benign Het
Knop1 G A 7: 118,455,009 (GRCm39) probably benign Het
Llgl2 C A 11: 115,743,947 (GRCm39) T758K probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc71 T C 3: 87,649,148 (GRCm39) D340G possibly damaging Het
Luzp1 A G 4: 136,270,636 (GRCm39) D953G probably damaging Het
Mst1r T C 9: 107,794,562 (GRCm39) V1247A probably damaging Het
Ncoa4 A T 14: 31,898,845 (GRCm39) K555M probably damaging Het
Ncoa6 A T 2: 155,257,224 (GRCm39) L773Q probably benign Het
Ndc1 C T 4: 107,228,485 (GRCm39) Q70* probably null Het
Nfe2l3 C T 6: 51,434,585 (GRCm39) L382F probably damaging Het
Nlrp4b C A 7: 10,458,979 (GRCm39) T399N possibly damaging Het
Nsmce2 T A 15: 59,473,234 (GRCm39) D250E probably damaging Het
Nudt14 A T 12: 112,898,548 (GRCm39) L184Q probably damaging Het
Ogdhl G A 14: 32,062,624 (GRCm39) R570H possibly damaging Het
Or5p56 T C 7: 107,590,048 (GRCm39) F159L probably benign Het
Plag1 A G 4: 3,904,085 (GRCm39) S369P probably benign Het
Ranbp2 A T 10: 58,318,916 (GRCm39) T2476S possibly damaging Het
Rnmt T C 18: 68,440,853 (GRCm39) L172P probably damaging Het
Sec24a T A 11: 51,634,623 (GRCm39) H101L probably benign Het
Sirpd T A 3: 15,385,744 (GRCm39) T53S possibly damaging Het
Srm A G 4: 148,677,881 (GRCm39) D173G probably damaging Het
Srp54b A G 12: 55,302,844 (GRCm39) D380G probably benign Het
Svs5 C T 2: 164,078,929 (GRCm39) R326Q possibly damaging Het
Tent4b T C 8: 88,972,227 (GRCm39) V222A probably damaging Het
Tfap2b C T 1: 19,304,294 (GRCm39) T350M probably damaging Het
Tie1 A T 4: 118,341,070 (GRCm39) C304S probably damaging Het
Tsc2 G T 17: 24,850,950 (GRCm39) T36N probably damaging Het
Wdhd1 A T 14: 47,505,649 (GRCm39) Y274* probably null Het
Wdr37 T C 13: 8,870,574 (GRCm39) T373A probably benign Het
Xirp2 A T 2: 67,342,634 (GRCm39) N1625I possibly damaging Het
Ythdf1 A C 2: 180,560,936 (GRCm39) S35A probably damaging Het
Zfp462 A G 4: 55,008,928 (GRCm39) N298S possibly damaging Het
Zfp541 T A 7: 15,812,437 (GRCm39) D363E probably benign Het
Zgpat A G 2: 181,020,658 (GRCm39) D277G probably benign Het
Znfx1 A T 2: 166,898,110 (GRCm39) N271K probably damaging Het
Other mutations in Pira13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Pira13 APN 7 3,826,088 (GRCm39) missense probably damaging 1.00
IGL01675:Pira13 APN 7 3,825,607 (GRCm39) splice site probably benign
IGL02040:Pira13 APN 7 3,824,516 (GRCm39) splice site probably benign
IGL02547:Pira13 APN 7 3,824,660 (GRCm39) missense probably damaging 0.98
IGL02749:Pira13 APN 7 3,825,624 (GRCm39) missense probably damaging 1.00
IGL02822:Pira13 APN 7 3,819,917 (GRCm39) missense possibly damaging 0.50
IGL02883:Pira13 APN 7 3,825,179 (GRCm39) missense possibly damaging 0.95
IGL03140:Pira13 APN 7 3,826,247 (GRCm39) missense probably benign 0.00
IGL03185:Pira13 APN 7 3,826,229 (GRCm39) missense probably damaging 1.00
IGL03212:Pira13 APN 7 3,826,132 (GRCm39) missense probably benign 0.00
R0347:Pira13 UTSW 7 3,825,873 (GRCm39) missense probably damaging 1.00
R0652:Pira13 UTSW 7 3,825,762 (GRCm39) missense probably benign 0.02
R0668:Pira13 UTSW 7 3,825,699 (GRCm39) missense probably damaging 0.99
R0724:Pira13 UTSW 7 3,819,871 (GRCm39) missense possibly damaging 0.83
R0735:Pira13 UTSW 7 3,824,781 (GRCm39) missense possibly damaging 0.79
R1074:Pira13 UTSW 7 3,826,069 (GRCm39) missense probably damaging 1.00
R1339:Pira13 UTSW 7 3,825,155 (GRCm39) missense probably damaging 1.00
R1570:Pira13 UTSW 7 3,826,060 (GRCm39) missense probably benign 0.45
R1880:Pira13 UTSW 7 3,827,950 (GRCm39) critical splice donor site probably null
R1892:Pira13 UTSW 7 3,827,573 (GRCm39) missense probably benign 0.15
R1909:Pira13 UTSW 7 3,825,918 (GRCm39) missense probably benign 0.31
R2881:Pira13 UTSW 7 3,828,640 (GRCm39) start codon destroyed probably null 0.98
R2967:Pira13 UTSW 7 3,825,686 (GRCm39) missense probably damaging 1.00
R2983:Pira13 UTSW 7 3,824,574 (GRCm39) missense probably damaging 1.00
R4213:Pira13 UTSW 7 3,824,553 (GRCm39) missense probably damaging 1.00
R4319:Pira13 UTSW 7 3,825,754 (GRCm39) missense possibly damaging 0.46
R4320:Pira13 UTSW 7 3,825,754 (GRCm39) missense possibly damaging 0.46
R4321:Pira13 UTSW 7 3,825,754 (GRCm39) missense possibly damaging 0.46
R4322:Pira13 UTSW 7 3,825,754 (GRCm39) missense possibly damaging 0.46
R4323:Pira13 UTSW 7 3,825,754 (GRCm39) missense possibly damaging 0.46
R4536:Pira13 UTSW 7 3,825,251 (GRCm39) missense probably benign 0.00
R4597:Pira13 UTSW 7 3,825,154 (GRCm39) missense possibly damaging 0.81
R4713:Pira13 UTSW 7 3,825,680 (GRCm39) nonsense probably null
R4725:Pira13 UTSW 7 3,824,547 (GRCm39) missense probably benign
R4934:Pira13 UTSW 7 3,825,676 (GRCm39) missense probably damaging 1.00
R4971:Pira13 UTSW 7 3,825,805 (GRCm39) missense probably benign 0.00
R5138:Pira13 UTSW 7 3,827,556 (GRCm39) nonsense probably null
R5805:Pira13 UTSW 7 3,825,622 (GRCm39) missense probably benign 0.15
R5824:Pira13 UTSW 7 3,827,753 (GRCm39) missense probably damaging 1.00
R5841:Pira13 UTSW 7 3,825,898 (GRCm39) nonsense probably null
R6027:Pira13 UTSW 7 3,827,638 (GRCm39) missense possibly damaging 0.94
R6214:Pira13 UTSW 7 3,824,717 (GRCm39) missense probably damaging 0.99
R6329:Pira13 UTSW 7 3,825,850 (GRCm39) missense probably damaging 1.00
R6429:Pira13 UTSW 7 3,825,345 (GRCm39) missense possibly damaging 0.63
R6650:Pira13 UTSW 7 3,819,898 (GRCm39) missense possibly damaging 0.83
R6681:Pira13 UTSW 7 3,825,251 (GRCm39) missense probably benign 0.00
R6961:Pira13 UTSW 7 3,828,124 (GRCm39) missense probably damaging 1.00
R6989:Pira13 UTSW 7 3,825,163 (GRCm39) missense possibly damaging 0.95
R7025:Pira13 UTSW 7 3,824,261 (GRCm39) nonsense probably null
R7071:Pira13 UTSW 7 3,824,667 (GRCm39) missense unknown
R7194:Pira13 UTSW 7 3,827,792 (GRCm39) missense
R7215:Pira13 UTSW 7 3,825,310 (GRCm39) missense unknown
R7580:Pira13 UTSW 7 3,827,611 (GRCm39) missense unknown
R7776:Pira13 UTSW 7 3,826,246 (GRCm39) missense unknown
R7863:Pira13 UTSW 7 3,827,801 (GRCm39) critical splice acceptor site probably null
R7909:Pira13 UTSW 7 3,824,708 (GRCm39) missense unknown
R8131:Pira13 UTSW 7 3,825,161 (GRCm39) nonsense probably null
R8178:Pira13 UTSW 7 3,824,260 (GRCm39) missense unknown
R8188:Pira13 UTSW 7 3,826,126 (GRCm39) missense unknown
R8220:Pira13 UTSW 7 3,825,903 (GRCm39) missense unknown
R8226:Pira13 UTSW 7 3,828,109 (GRCm39) missense
R8441:Pira13 UTSW 7 3,826,301 (GRCm39) nonsense probably null
R8739:Pira13 UTSW 7 3,828,188 (GRCm39) missense
R8785:Pira13 UTSW 7 3,819,928 (GRCm39) missense unknown
R8912:Pira13 UTSW 7 3,825,818 (GRCm39) missense unknown
R8941:Pira13 UTSW 7 3,825,380 (GRCm39) missense probably damaging 1.00
R8990:Pira13 UTSW 7 3,824,273 (GRCm39) missense unknown
R9049:Pira13 UTSW 7 3,819,890 (GRCm39) missense unknown
R9090:Pira13 UTSW 7 3,819,997 (GRCm39) missense unknown
R9134:Pira13 UTSW 7 3,825,182 (GRCm39) missense
R9136:Pira13 UTSW 7 3,826,285 (GRCm39) missense
R9244:Pira13 UTSW 7 3,825,226 (GRCm39) missense unknown
R9271:Pira13 UTSW 7 3,819,997 (GRCm39) missense unknown
R9328:Pira13 UTSW 7 3,827,580 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGTTCAGGAAACAAAGGCTCCCAG -3'
(R):5'- TGGAACTCAGAAGAAACACTACGGC -3'

Sequencing Primer
(F):5'- TGAGGAAGCACCTCATTATGAC -3'
(R):5'- GCTGAGAACATCTGTTCATGC -3'
Posted On 2014-04-13