Incidental Mutation 'R1541:Zfp541'
ID171730
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Namezinc finger protein 541
SynonymsEG666528
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R1541 (G1)
Quality Score146
Status Not validated
Chromosome7
Chromosomal Location16061814-16096334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16078512 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 363 (D363E)
Ref Sequence ENSEMBL: ENSMUSP00000148143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
Predicted Effect probably benign
Transcript: ENSMUST00000108509
AA Change: D363E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: D363E

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209369
AA Change: D363E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000210805
AA Change: D363E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 16079468 missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 16079695 missense probably damaging 1.00
IGL02347:Zfp541 APN 7 16083465 missense probably damaging 1.00
IGL02516:Zfp541 APN 7 16082993 splice site probably null
R0101:Zfp541 UTSW 7 16078043 missense probably damaging 1.00
R0412:Zfp541 UTSW 7 16082174 missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 16095682 splice site probably benign
R0784:Zfp541 UTSW 7 16082992 intron probably benign
R1083:Zfp541 UTSW 7 16078712 missense probably benign 0.16
R1575:Zfp541 UTSW 7 16078715 missense possibly damaging 0.94
R1730:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1783:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1966:Zfp541 UTSW 7 16079071 missense probably benign 0.02
R2022:Zfp541 UTSW 7 16082185 missense probably damaging 1.00
R2048:Zfp541 UTSW 7 16078327 missense possibly damaging 0.94
R2436:Zfp541 UTSW 7 16076448 missense possibly damaging 0.94
R3973:Zfp541 UTSW 7 16072222 missense probably damaging 1.00
R4081:Zfp541 UTSW 7 16072135 missense probably benign 0.16
R4589:Zfp541 UTSW 7 16083336 missense probably benign 0.35
R4724:Zfp541 UTSW 7 16081687 missense probably damaging 0.99
R4812:Zfp541 UTSW 7 16079110 missense probably benign 0.01
R4817:Zfp541 UTSW 7 16090382 missense probably damaging 1.00
R5232:Zfp541 UTSW 7 16095179 missense probably damaging 1.00
R5331:Zfp541 UTSW 7 16095758 missense probably damaging 1.00
R5551:Zfp541 UTSW 7 16090861 missense probably damaging 1.00
R5976:Zfp541 UTSW 7 16076419 missense probably benign 0.34
R6259:Zfp541 UTSW 7 16095526 missense probably benign 0.02
R6523:Zfp541 UTSW 7 16095520 missense probably damaging 1.00
R6826:Zfp541 UTSW 7 16078982 missense probably damaging 0.96
R7319:Zfp541 UTSW 7 16079369 missense probably benign 0.21
R7428:Zfp541 UTSW 7 16092868 missense probably damaging 1.00
R7594:Zfp541 UTSW 7 16076386 missense probably damaging 0.96
R7724:Zfp541 UTSW 7 16071994 missense probably damaging 1.00
R8276:Zfp541 UTSW 7 16079084 missense possibly damaging 0.87
Z1088:Zfp541 UTSW 7 16079795 missense probably benign 0.16
Z1176:Zfp541 UTSW 7 16078266 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16078763 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16079029 missense probably benign 0.26
Z1177:Zfp541 UTSW 7 16082167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTGTGAGCAGCATCGTCCACC -3'
(R):5'- TGCCTTTGTTCTTGGGACAGCC -3'

Sequencing Primer
(F):5'- GGCCTTCTGATACTGAAGCAAG -3'
(R):5'- TTGGGACAGCCAGGCAG -3'
Posted On2014-04-13