Incidental Mutation 'R1541:Olfr477'
ID171734
Institutional Source Beutler Lab
Gene Symbol Olfr477
Ensembl Gene ENSMUSG00000096151
Gene Nameolfactory receptor 477
SynonymsGA_x6K02T2PBJ9-10319672-10320604, MOR204-1
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107986693-107992723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107990841 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 159 (F159L)
Ref Sequence ENSEMBL: ENSMUSP00000091654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091605] [ENSMUST00000214677]
Predicted Effect probably benign
Transcript: ENSMUST00000091605
AA Change: F159L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091654
Gene: ENSMUSG00000096151
AA Change: F159L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 290 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214677
AA Change: F159L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Olfr477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr477 APN 7 107990890 missense probably damaging 0.97
IGL01078:Olfr477 APN 7 107990943 missense probably benign 0.02
IGL01141:Olfr477 APN 7 107990551 missense probably damaging 1.00
IGL02613:Olfr477 APN 7 107991174 nonsense probably null
R0625:Olfr477 UTSW 7 107991189 missense probably damaging 1.00
R0791:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1254:Olfr477 UTSW 7 107990440 missense probably benign 0.01
R1456:Olfr477 UTSW 7 107990398 missense probably benign 0.06
R1522:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R2889:Olfr477 UTSW 7 107990577 missense probably benign 0.06
R5653:Olfr477 UTSW 7 107990385 missense probably benign 0.38
R6146:Olfr477 UTSW 7 107990413 missense probably damaging 1.00
R6190:Olfr477 UTSW 7 107991100 missense probably damaging 1.00
R7103:Olfr477 UTSW 7 107990598 missense possibly damaging 0.92
R7191:Olfr477 UTSW 7 107990646 missense possibly damaging 0.88
R7553:Olfr477 UTSW 7 107990475 missense probably benign 0.03
R7681:Olfr477 UTSW 7 107991148 missense possibly damaging 0.80
Z1088:Olfr477 UTSW 7 107990731 missense probably benign 0.42
Z1177:Olfr477 UTSW 7 107991094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGGAGGCTCAAAACCACAC -3'
(R):5'- GGAGCGCATATTCAGGATGGTGATG -3'

Sequencing Primer
(F):5'- TCAGTTTAATAAGGAGCTGCCCC -3'
(R):5'- TAGGTGTAGGAGACAGCTATGAC -3'
Posted On2014-04-13