Incidental Mutation 'R1541:Grip1'
ID171746
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120000543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 440 (I440T)
Ref Sequence ENSEMBL: ENSMUSP00000121670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000081260] [ENSMUST00000105261] [ENSMUST00000105262] [ENSMUST00000130387] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954] [ENSMUST00000154238]
Predicted Effect probably benign
Transcript: ENSMUST00000041962
AA Change: I468T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: I468T

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077871
AA Change: I441T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: I441T

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081260
AA Change: I104T

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813
AA Change: I104T

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 3e-19 SMART
PDZ 166 242 5.2e-19 SMART
PDZ 265 339 8.4e-21 SMART
PDZ 518 590 1.4e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105261
AA Change: I104T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100896
Gene: ENSMUSG00000034813
AA Change: I104T

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 518 590 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105262
AA Change: I467T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: I467T

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably benign
Transcript: ENSMUST00000130387
AA Change: I104T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813
AA Change: I104T

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 583 655 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138410
AA Change: I519T

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: I519T

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably damaging
Transcript: ENSMUST00000144825
AA Change: I440T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: I440T

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
AA Change: I519T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: I519T

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
AA Change: I520T

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: I520T

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147454
AA Change: I519T

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: I519T

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147598
Predicted Effect probably benign
Transcript: ENSMUST00000148954
AA Change: I467T

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: I467T

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154238
AA Change: I104T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122349
Gene: ENSMUSG00000034813
AA Change: I104T

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 598 670 2.79e-13 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
R7586:Grip1 UTSW 10 120077138 splice site probably null
R7768:Grip1 UTSW 10 120038397 missense probably damaging 0.98
R7831:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7896:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
R8103:Grip1 UTSW 10 119978535 missense probably benign 0.00
R8254:Grip1 UTSW 10 120054905 nonsense probably null
RF011:Grip1 UTSW 10 119931315 missense probably null 0.97
Z1176:Grip1 UTSW 10 119819483 unclassified probably benign
Z1177:Grip1 UTSW 10 119986444 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTTGCCAATAGCATCAGCTCAAC -3'
(R):5'- AACAGTCCTGGAGTCCTCCTTGTC -3'

Sequencing Primer
(F):5'- CTCAACAAGGTCAAATGGTTGTG -3'
(R):5'- atacacacataGCTGATGTGTCTTTC -3'
Posted On2014-04-13