Incidental Mutation 'R1541:Sec24a'
ID171747
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene NameSec24 related gene family, member A (S. cerevisiae)
Synonyms9430090N21Rik
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51692264-51763634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51743796 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 101 (H101L)
Ref Sequence ENSEMBL: ENSMUSP00000104720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000064297] [ENSMUST00000109092] [ENSMUST00000109097]
Predicted Effect probably benign
Transcript: ENSMUST00000038210
AA Change: H101L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064297
AA Change: H101L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068065
Gene: ENSMUSG00000036391
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 3.5e-18 PFAM
Pfam:Sec23_trunk 498 589 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109092
AA Change: H101L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104720
Gene: ENSMUSG00000036391
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 3.9e-19 PFAM
Pfam:Sec23_trunk 497 588 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109097
AA Change: H101L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154325
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51736504 nonsense probably null
IGL00973:Sec24a APN 11 51729577 critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51713529 critical splice donor site probably null
IGL01476:Sec24a APN 11 51708956 missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51723578 splice site probably null
IGL02069:Sec24a APN 11 51733934 splice site probably benign
IGL02230:Sec24a APN 11 51709034 missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51712187 critical splice donor site probably null
IGL02655:Sec24a APN 11 51734655 missense probably benign 0.43
IGL02756:Sec24a APN 11 51696733 missense probably benign 0.02
IGL03396:Sec24a APN 11 51708967 missense probably benign 0.17
R0153:Sec24a UTSW 11 51700826 missense probably benign 0.08
R0506:Sec24a UTSW 11 51743795 missense probably benign 0.03
R0625:Sec24a UTSW 11 51729454 missense probably damaging 0.98
R1084:Sec24a UTSW 11 51713581 missense probably damaging 1.00
R1166:Sec24a UTSW 11 51733467 missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51700913 splice site probably benign
R1487:Sec24a UTSW 11 51731886 missense possibly damaging 0.92
R1582:Sec24a UTSW 11 51708967 missense probably benign 0.17
R1643:Sec24a UTSW 11 51704385 missense probably benign 0.03
R1672:Sec24a UTSW 11 51743948 nonsense probably null
R1681:Sec24a UTSW 11 51695189 missense probably damaging 0.98
R1756:Sec24a UTSW 11 51733763 splice site probably benign
R1992:Sec24a UTSW 11 51736363 missense probably benign 0.00
R2159:Sec24a UTSW 11 51712350 missense probably damaging 1.00
R2177:Sec24a UTSW 11 51704401 missense probably benign 0.00
R2188:Sec24a UTSW 11 51723584 missense probably damaging 0.99
R2271:Sec24a UTSW 11 51716450 missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51729458 missense probably damaging 1.00
R4349:Sec24a UTSW 11 51715149 missense probably benign 0.03
R4396:Sec24a UTSW 11 51715164 missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51721813 critical splice donor site probably null
R5061:Sec24a UTSW 11 51713532 splice site probably null
R5577:Sec24a UTSW 11 51734621 missense probably benign 0.06
R5717:Sec24a UTSW 11 51707210 missense probably benign
R5915:Sec24a UTSW 11 51756137 missense probably benign 0.11
R6175:Sec24a UTSW 11 51731891 missense probably damaging 1.00
R6341:Sec24a UTSW 11 51717776 missense probably damaging 0.99
R6461:Sec24a UTSW 11 51713546 missense possibly damaging 0.76
R6610:Sec24a UTSW 11 51696656 missense probably benign
R6632:Sec24a UTSW 11 51713649 nonsense probably null
R6907:Sec24a UTSW 11 51712276 missense probably damaging 1.00
R6969:Sec24a UTSW 11 51700816 missense probably benign 0.35
R7132:Sec24a UTSW 11 51715136 nonsense probably null
R7274:Sec24a UTSW 11 51707255 missense probably damaging 1.00
R7475:Sec24a UTSW 11 51713552 missense probably damaging 1.00
R7699:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7700:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R8042:Sec24a UTSW 11 51704317 missense probably benign
X0025:Sec24a UTSW 11 51729547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGAAGTGCAGGGTCTCCAGAAG -3'
(R):5'- AAGGCTATGATTCGCAACCTCCAG -3'

Sequencing Primer
(F):5'- CAGGGTCTCCAGAAGAAACATATTG -3'
(R):5'- ACAGTCGAACTACGGTGGTT -3'
Posted On2014-04-13