Incidental Mutation 'R1541:Ncoa4'
ID171758
Institutional Source Beutler Lab
Gene Symbol Ncoa4
Ensembl Gene ENSMUSG00000056234
Gene Namenuclear receptor coactivator 4
Synonyms
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32159865-32179855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32176888 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 555 (K555M)
Ref Sequence ENSEMBL: ENSMUSP00000126071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000163379] [ENSMUST00000164341] [ENSMUST00000168034] [ENSMUST00000168114] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000170331] [ENSMUST00000226479] [ENSMUST00000226683]
Predicted Effect probably benign
Transcript: ENSMUST00000013845
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111994
AA Change: K555M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234
AA Change: K555M

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163336
AA Change: K555M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234
AA Change: K555M

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164341
SMART Domains Protein: ENSMUSP00000126780
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 99 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168034
SMART Domains Protein: ENSMUSP00000129422
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 45 131 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168114
SMART Domains Protein: ENSMUSP00000131253
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 64 105 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168139
Predicted Effect probably benign
Transcript: ENSMUST00000168334
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169722
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226479
Predicted Effect probably benign
Transcript: ENSMUST00000226683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228779
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mouse embryonic fibroblasts isolated from homozygous null mice exhibit abnormal DNA replication, decreased fibroblast proliferation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Ncoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ncoa4 APN 14 32172927 missense probably benign 0.19
IGL02963:Ncoa4 APN 14 32176509 missense probably damaging 1.00
IGL03062:Ncoa4 APN 14 32173420 missense possibly damaging 0.89
R0613:Ncoa4 UTSW 14 32176552 missense probably damaging 1.00
R1353:Ncoa4 UTSW 14 32170858 nonsense probably null
R1395:Ncoa4 UTSW 14 32172841 intron probably null
R1430:Ncoa4 UTSW 14 32176722 missense probably benign 0.00
R1509:Ncoa4 UTSW 14 32173434 missense probably damaging 1.00
R2292:Ncoa4 UTSW 14 32173456 missense probably damaging 0.98
R4610:Ncoa4 UTSW 14 32176725 missense probably benign 0.01
R4713:Ncoa4 UTSW 14 32176641 missense probably benign 0.05
R5750:Ncoa4 UTSW 14 32177307 nonsense probably null
R5889:Ncoa4 UTSW 14 32166659 unclassified probably benign
R5928:Ncoa4 UTSW 14 32166721 critical splice donor site probably null
R6738:Ncoa4 UTSW 14 32170793 missense probably benign
R7065:Ncoa4 UTSW 14 32172900 nonsense probably null
R7165:Ncoa4 UTSW 14 32175983 missense probably damaging 0.97
R7257:Ncoa4 UTSW 14 32177369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTTCCAGAAATGAGCTAACAG -3'
(R):5'- GCAGCTTGAATGCTAAGGACCTGAG -3'

Sequencing Primer
(F):5'- ATGGCTCCTGCTAGAATTGC -3'
(R):5'- TGCTAAGGACCTGAGAAACTC -3'
Posted On2014-04-13