Incidental Mutation 'R1541:Dzip1'
ID171763
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene NameDAZ interacting protein 1
Synonyms2510025K24Rik, 2810422M04Rik
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R1541 (G1)
Quality Score161
Status Not validated
Chromosome14
Chromosomal Location118875520-118925460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118879478 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 782 (S782L)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208] [ENSMUST00000047761] [ENSMUST00000071546] [ENSMUST00000100314]
Predicted Effect probably damaging
Transcript: ENSMUST00000004055
AA Change: S782L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: S782L

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047208
AA Change: S782L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: S782L

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047761
SMART Domains Protein: ENSMUSP00000041616
Gene: ENSMUSG00000022132

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 9.2e-44 PFAM
Pfam:Claudin_2 13 179 3.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071546
SMART Domains Protein: ENSMUSP00000071476
Gene: ENSMUSG00000022132

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 167 9e-35 PFAM
Pfam:Claudin_2 13 160 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100314
SMART Domains Protein: ENSMUSP00000097889
Gene: ENSMUSG00000022132

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 179 9.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228687
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118883394 missense probably benign 0.41
IGL01534:Dzip1 APN 14 118877239 missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118881065 missense probably benign 0.16
IGL02537:Dzip1 APN 14 118909576 splice site probably benign
IGL02801:Dzip1 APN 14 118885655 nonsense probably null
IGL03354:Dzip1 APN 14 118912569 splice site probably benign
BB003:Dzip1 UTSW 14 118883499 missense probably benign 0.00
BB013:Dzip1 UTSW 14 118883499 missense probably benign 0.00
PIT4151001:Dzip1 UTSW 14 118922788 missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118909557 missense probably damaging 0.99
R0357:Dzip1 UTSW 14 118909538 missense probably damaging 0.99
R0592:Dzip1 UTSW 14 118902139 missense probably damaging 1.00
R0942:Dzip1 UTSW 14 118887197 nonsense probably null
R1110:Dzip1 UTSW 14 118889305 missense probably benign 0.15
R1458:Dzip1 UTSW 14 118922713 missense probably benign 0.16
R2046:Dzip1 UTSW 14 118922478 missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118889404 splice site probably null
R2316:Dzip1 UTSW 14 118901540 missense probably benign 0.01
R2504:Dzip1 UTSW 14 118881044 missense probably benign 0.11
R2851:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118911368 missense probably benign 0.38
R4111:Dzip1 UTSW 14 118877233 nonsense probably null
R4349:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4350:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4351:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4352:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4868:Dzip1 UTSW 14 118877214 missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118887151 missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118887232 critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118909480 missense probably benign 0.00
R7256:Dzip1 UTSW 14 118885646 missense probably benign 0.00
R7768:Dzip1 UTSW 14 118879498 missense probably benign 0.11
R7788:Dzip1 UTSW 14 118883393 missense probably benign 0.00
R7926:Dzip1 UTSW 14 118883499 missense probably benign 0.00
X0009:Dzip1 UTSW 14 118877214 missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118922457 missense probably damaging 1.00
Z1177:Dzip1 UTSW 14 118911376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGACAGTGATCTGATCATGC -3'
(R):5'- GCTCAGAGAAGCTGCCTCTGTTTG -3'

Sequencing Primer
(F):5'- tgggagagcagggatgag -3'
(R):5'- ATCAGCTGCTCAGCCTAAAC -3'
Posted On2014-04-13