Incidental Mutation 'R1541:Atat1'
ID171769
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35904331 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 181 (N181I)
Ref Sequence ENSEMBL: ENSMUSP00000122715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000149277]
Predicted Effect probably damaging
Transcript: ENSMUST00000056034
AA Change: N181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: N181I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061052
AA Change: N181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: N181I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077494
AA Change: N181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: N181I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126744
AA Change: N72I
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426
AA Change: N72I

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137069
Predicted Effect probably benign
Transcript: ENSMUST00000137182
Predicted Effect probably benign
Transcript: ENSMUST00000140292
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140990
Predicted Effect probably damaging
Transcript: ENSMUST00000141132
AA Change: N138I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426
AA Change: N138I

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141662
AA Change: N181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: N181I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149277
AA Change: N181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: N181I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174436
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R0633:Atat1 UTSW 17 35901423 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2054:Atat1 UTSW 17 35901369 missense probably null 0.99
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R6380:Atat1 UTSW 17 35908957 unclassified probably null
R7010:Atat1 UTSW 17 35908630 missense probably damaging 1.00
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R7520:Atat1 UTSW 17 35897814 missense probably benign 0.36
R7607:Atat1 UTSW 17 35909107 missense possibly damaging 0.48
R8104:Atat1 UTSW 17 35904116 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATTGCCAGCAGATAGCACTGCC -3'
(R):5'- tctccagccccATGTTTTAACCttg -3'

Sequencing Primer
(F):5'- CAGGCTTTACCAGCAGGTATG -3'
(R):5'- actcatcctcctacctttccc -3'
Posted On2014-04-13