Mutagenetix > Incidental Mutation

Incidental Mutation 'R1541:Cfap43'

171771

Institutional Source

Beutler Lab

Gene Symbol

Cfap43

Ensembl Gene

ENSMUSG00000044948

Gene Name

cilia and flagella associated protein 43

Synonyms

4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96

MMRRC Submission

039580-MU

Accession Numbers

Genbank: NM_027559

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R1541 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47737561-47919299 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 47763852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160247]

AlphaFold

E9Q7R9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159999

Predicted Effect

probably null
Transcript: ENSMUST00000160247

SMART Domains

Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC
Blast:WD40	70	111	6e-7	BLAST
Blast:WD40	115	156	1e-5	BLAST
Blast:WD40	162	197	8e-10	BLAST
WD40	349	388	1.07e0	SMART
Blast:WD40	392	432	3e-13	BLAST
WD40	435	473	3.96e1	SMART
WD40	479	518	3.82e1	SMART
Blast:WD40	638	683	8e-17	BLAST
Blast:WD40	689	728	1e-17	BLAST
low complexity region	766	781	N/A	INTRINSIC
coiled coil region	855	886	N/A	INTRINSIC
coiled coil region	925	961	N/A	INTRINSIC
low complexity region	971	981	N/A	INTRINSIC
coiled coil region	1170	1224	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
low complexity region	1268	1279	N/A	INTRINSIC
low complexity region	1524	1529	N/A	INTRINSIC
coiled coil region	1652	1671	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161832

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162657

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	A	G	14: 103,049,333	D24G	probably damaging	Het
Angptl2	G	A	2: 33,246,165	R454H	probably benign	Het
Atat1	T	A	17: 35,904,331	N181I	probably damaging	Het
Atp6v0d2	A	C	4: 19,910,645	F82V	probably damaging	Het
BC100530	T	A	16: 36,367,501	M1L	probably damaging	Het
Casp3	A	G	8: 46,634,334	I105M	probably benign	Het
Ccdc33	T	A	9: 58,117,466	D159V	probably damaging	Het
Cd163	A	C	6: 124,327,961	D1099A	probably benign	Het
Cep128	A	T	12: 91,348,781	S110R	probably damaging	Het
Cfap58	T	C	19: 47,983,530	I633T	probably damaging	Het
Clvs1	A	G	4: 9,281,814	H86R	probably benign	Het
Comt	T	C	16: 18,411,815	K48R	probably benign	Het
Crip2	T	C	12: 113,144,966	V64A	possibly damaging	Het
Cwf19l2	T	A	9: 3,456,760	S698T	probably damaging	Het
Dis3l	T	C	9: 64,307,489	I933V	probably benign	Het
Dnah8	C	A	17: 30,747,247	N2470K	probably damaging	Het
Dstn	T	C	2: 143,938,488	V36A	possibly damaging	Het
Dtx1	T	A	5: 120,710,346		probably benign	Het
Dzip1	G	A	14: 118,879,478	S782L	probably damaging	Het
Ece1	T	A	4: 137,948,660		probably null	Het
Erich1	A	G	8: 14,030,688	I277T	probably damaging	Het
Fam26d	T	C	10: 34,041,663	H264R	probably benign	Het
Gbp4	T	A	5: 105,118,409	M589L	probably benign	Het
Gm15448	T	C	7: 3,816,989	D525G	probably damaging	Het
Gm9733	T	A	3: 15,320,684	T53S	possibly damaging	Het
Grip1	T	C	10: 120,000,543	I440T	probably damaging	Het
Helz	C	T	11: 107,670,048	S1311L	probably benign	Het
Herc2	A	T	7: 56,135,657	I1552F	probably damaging	Het
Kif13a	T	C	13: 46,809,213	T459A	probably benign	Het
Knop1	G	A	7: 118,855,786		probably benign	Het
Llgl2	C	A	11: 115,853,121	T758K	probably benign	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc71	T	C	3: 87,741,841	D340G	possibly damaging	Het
Luzp1	A	G	4: 136,543,325	D953G	probably damaging	Het
Mst1r	T	C	9: 107,917,363	V1247A	probably damaging	Het
Ncoa4	A	T	14: 32,176,888	K555M	probably damaging	Het
Ncoa6	A	T	2: 155,415,304	L773Q	probably benign	Het
Ndc1	C	T	4: 107,371,288	Q70*	probably null	Het
Nfe2l3	C	T	6: 51,457,605	L382F	probably damaging	Het
Nlrp4b	C	A	7: 10,725,052	T399N	possibly damaging	Het
Nsmce2	T	A	15: 59,601,385	D250E	probably damaging	Het
Nudt14	A	T	12: 112,934,928	L184Q	probably damaging	Het
Ogdhl	G	A	14: 32,340,667	R570H	possibly damaging	Het
Olfr477	T	C	7: 107,990,841	F159L	probably benign	Het
Papd5	T	C	8: 88,245,599	V222A	probably damaging	Het
Plag1	A	G	4: 3,904,085	S369P	probably benign	Het
Ranbp2	A	T	10: 58,483,094	T2476S	possibly damaging	Het
Rnmt	T	C	18: 68,307,782	L172P	probably damaging	Het
Sec24a	T	A	11: 51,743,796	H101L	probably benign	Het
Srm	A	G	4: 148,593,424	D173G	probably damaging	Het
Srp54b	A	G	12: 55,256,059	D380G	probably benign	Het
Svs2	C	T	2: 164,237,009	R326Q	possibly damaging	Het
Tfap2b	C	T	1: 19,234,070	T350M	probably damaging	Het
Tie1	A	T	4: 118,483,873	C304S	probably damaging	Het
Tsc2	G	T	17: 24,631,976	T36N	probably damaging	Het
Wdhd1	A	T	14: 47,268,192	Y274*	probably null	Het
Wdr37	T	C	13: 8,820,538	T373A	probably benign	Het
Xirp2	A	T	2: 67,512,290	N1625I	possibly damaging	Het
Ythdf1	A	C	2: 180,919,143	S35A	probably damaging	Het
Zfp462	A	G	4: 55,008,928	N298S	possibly damaging	Het
Zfp541	T	A	7: 16,078,512	D363E	probably benign	Het
Zgpat	A	G	2: 181,378,865	D277G	probably benign	Het
Znfx1	A	T	2: 167,056,190	N271K	probably damaging	Het

Other mutations in Cfap43

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cfap43	APN	19	47830475	missense	probably benign	0.08
IGL00325:Cfap43	APN	19	47823188	splice site	probably benign
IGL00918:Cfap43	APN	19	47896661	missense	probably damaging	1.00
IGL01402:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01404:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01656:Cfap43	APN	19	47751900	missense	possibly damaging	0.95
IGL01738:Cfap43	APN	19	47797185	missense	probably damaging	0.97
IGL02168:Cfap43	APN	19	47751923	splice site	probably benign
IGL02225:Cfap43	APN	19	47812177	missense	probably benign	0.00
IGL02308:Cfap43	APN	19	47748024	missense	probably benign
IGL02354:Cfap43	APN	19	47897413	nonsense	probably null
IGL02361:Cfap43	APN	19	47897413	nonsense	probably null
IGL03283:Cfap43	APN	19	47791412	splice site	probably benign
3-1:Cfap43	UTSW	19	47751855	missense	probably benign	0.02
IGL03046:Cfap43	UTSW	19	47815863	missense	probably damaging	1.00
PIT4495001:Cfap43	UTSW	19	47897302	missense	probably damaging	1.00
R0270:Cfap43	UTSW	19	47797203	splice site	probably benign
R0421:Cfap43	UTSW	19	47835575	missense	probably benign	0.00
R0433:Cfap43	UTSW	19	47825771	missense	probably benign	0.44
R0576:Cfap43	UTSW	19	47797140	missense	probably benign	0.00
R0646:Cfap43	UTSW	19	47763676	missense	probably benign	0.25
R0740:Cfap43	UTSW	19	47835804	missense	possibly damaging	0.95
R0836:Cfap43	UTSW	19	47815846	missense	probably benign	0.02
R0899:Cfap43	UTSW	19	47747994	missense	possibly damaging	0.93
R1171:Cfap43	UTSW	19	47835711	missense	probably benign	0.03
R1271:Cfap43	UTSW	19	47739744	missense	probably benign	0.22
R1271:Cfap43	UTSW	19	47747948	missense	probably damaging	0.98
R1371:Cfap43	UTSW	19	47835606	missense	possibly damaging	0.95
R1469:Cfap43	UTSW	19	47896875	missense	probably damaging	1.00
R1625:Cfap43	UTSW	19	47751088	missense	probably damaging	1.00
R1679:Cfap43	UTSW	19	47773114	missense	probably benign	0.00
R1690:Cfap43	UTSW	19	47751066	critical splice donor site	probably null
R1820:Cfap43	UTSW	19	47897216	missense	probably damaging	0.99
R1891:Cfap43	UTSW	19	47813941	missense	probably damaging	0.97
R1956:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R1958:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R2110:Cfap43	UTSW	19	47835758	missense	probably damaging	1.00
R2118:Cfap43	UTSW	19	47770438	missense	probably damaging	1.00
R2290:Cfap43	UTSW	19	47773135	missense	probably damaging	0.99
R3691:Cfap43	UTSW	19	47897073	missense	probably benign	0.01
R3765:Cfap43	UTSW	19	47835575	missense	probably benign	0.01
R3917:Cfap43	UTSW	19	47897750	missense	probably benign	0.00
R3924:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R3925:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R3947:Cfap43	UTSW	19	47765979	missense	probably benign	0.28
R4256:Cfap43	UTSW	19	47782405	missense	probably benign	0.06
R4385:Cfap43	UTSW	19	47797129	missense	probably benign	0.28
R4395:Cfap43	UTSW	19	47751913	missense	probably benign	0.00
R4405:Cfap43	UTSW	19	47739797	missense	possibly damaging	0.57
R4541:Cfap43	UTSW	19	47748015	missense	probably benign	0.02
R4583:Cfap43	UTSW	19	47837216	missense	probably null	0.99
R4690:Cfap43	UTSW	19	47747859	missense	probably benign	0.45
R4852:Cfap43	UTSW	19	47897111	missense	possibly damaging	0.87
R5185:Cfap43	UTSW	19	47780394	missense	probably benign	0.00
R5192:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5196:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5197:Cfap43	UTSW	19	47897372	missense	probably damaging	1.00
R5205:Cfap43	UTSW	19	47897548	missense	possibly damaging	0.76
R5425:Cfap43	UTSW	19	47896932	missense	possibly damaging	0.94
R5516:Cfap43	UTSW	19	47738209	splice site	probably null
R5644:Cfap43	UTSW	19	47795675	missense	possibly damaging	0.66
R5844:Cfap43	UTSW	19	47795696	missense	probably benign
R5901:Cfap43	UTSW	19	47897099	missense	probably damaging	0.97
R5910:Cfap43	UTSW	19	47780271	missense	possibly damaging	0.63
R5920:Cfap43	UTSW	19	47760896	missense	possibly damaging	0.88
R5963:Cfap43	UTSW	19	47745574	missense	probably benign	0.42
R6817:Cfap43	UTSW	19	47756085	missense	possibly damaging	0.88
R6974:Cfap43	UTSW	19	47785278	critical splice donor site	probably null
R7219:Cfap43	UTSW	19	47791473	missense	probably benign	0.02
R7270:Cfap43	UTSW	19	47739785	missense	possibly damaging	0.86
R7733:Cfap43	UTSW	19	47897993	missense	possibly damaging	0.75
R7995:Cfap43	UTSW	19	47898023	missense	probably damaging	1.00
R8013:Cfap43	UTSW	19	47773109	missense	probably damaging	0.99
R8176:Cfap43	UTSW	19	47795675	missense	probably benign	0.00
R8242:Cfap43	UTSW	19	47897369	missense	probably damaging	1.00
R8303:Cfap43	UTSW	19	47765835	nonsense	probably null
R8333:Cfap43	UTSW	19	47897326	nonsense	probably null
R8353:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8453:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8474:Cfap43	UTSW	19	47897924	missense	probably benign	0.32
R8478:Cfap43	UTSW	19	47776076	missense	probably benign	0.02
R8676:Cfap43	UTSW	19	47748017	missense	possibly damaging	0.95
R8928:Cfap43	UTSW	19	47815960	missense	probably benign	0.00
R9190:Cfap43	UTSW	19	47737854	missense	possibly damaging	0.65
R9426:Cfap43	UTSW	19	47825798	missense	probably damaging	0.99
R9450:Cfap43	UTSW	19	47897871	missense	probably benign	0.23
R9491:Cfap43	UTSW	19	47812066	critical splice donor site	probably null
R9515:Cfap43	UTSW	19	47785375	missense	probably damaging	1.00
R9732:Cfap43	UTSW	19	47787007	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGAAACTTAGTGCTGCCTGATG -3'
(R):5'- GCTGCTGCCTTAATTCAAACCTGAC -3'

Sequencing Primer
(F):5'- gggataagatgggataagaaggg -3'
(R):5'- GCCTTAATTCAAACCTGACTACAAAC -3'

Posted On

2014-04-13