Mutagenetix > Incidental Mutations

Incidental Mutation 'R1542:Rb1cc1'

171773

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

039581-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 6244249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 382 (V382I)

Ref Sequence

ENSEMBL: ENSMUSP00000027040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]

AlphaFold

Q9ESK9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027040
AA Change: V382I

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: V382I

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159802

Predicted Effect

unknown
Transcript: ENSMUST00000161327
AA Change: V261I

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: V261I

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162257

SMART Domains

Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
coiled coil region	33	331	N/A	INTRINSIC
low complexity region	335	355	N/A	INTRINSIC
coiled coil region	363	483	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162795
AA Change: V382I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907
AA Change: V382I

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	2e-4	SMART
Blast:UBQ	3	76	4e-12	BLAST
low complexity region	454	469	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
coiled coil region	842	865	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R0837:Rb1cc1	UTSW	1	6234271	splice site	probably null
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3850:Rb1cc1	UTSW	1	6250113	missense	probably benign	0.22
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5196:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6313:Rb1cc1	UTSW	1	6244133	missense	probably benign	0.00
R6345:Rb1cc1	UTSW	1	6263257	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7618:Rb1cc1	UTSW	1	6265558	splice site	probably null
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R7774:Rb1cc1	UTSW	1	6248085	missense	possibly damaging	0.63
R7780:Rb1cc1	UTSW	1	6248914	nonsense	probably null
R7947:Rb1cc1	UTSW	1	6248562	missense	probably damaging	1.00
R8057:Rb1cc1	UTSW	1	6245219	missense	probably damaging	1.00
R8094:Rb1cc1	UTSW	1	6263224	nonsense	probably null
R8527:Rb1cc1	UTSW	1	6244875	missense	probably damaging	1.00
R8758:Rb1cc1	UTSW	1	6240227	missense	probably benign	0.10
R8843:Rb1cc1	UTSW	1	6245171	missense	probably damaging	1.00
R8922:Rb1cc1	UTSW	1	6248970	missense	probably benign
R8937:Rb1cc1	UTSW	1	6263217	missense	probably benign
R9018:Rb1cc1	UTSW	1	6249266	missense	probably benign
R9106:Rb1cc1	UTSW	1	6248885	missense
R9127:Rb1cc1	UTSW	1	6262849	missense	probably damaging	1.00
R9130:Rb1cc1	UTSW	1	6244885	missense	probably damaging	0.99
R9311:Rb1cc1	UTSW	1	6240315	missense	probably damaging	1.00
R9365:Rb1cc1	UTSW	1	6244893	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAAGAGTGGGTTTGTCATTAGCTCC -3'
(R):5'- AGGAAAACTCCAGTCCATCAAGTGTG -3'

Sequencing Primer
(F):5'- AACACCAGTTGTTTAGGATGGG -3'
(R):5'- TCCATCAAGTGTGACAAGCG -3'

Posted On

2014-04-13