Incidental Mutation 'R1542:Pik3c2b'
ID171779
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
SynonymsC330011J12Rik, PI3K-C2beta
MMRRC Submission 039581-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R1542 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133045667-133108687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133090034 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 915 (L915P)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: L915P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: L915P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,406 M208T possibly damaging Het
Acsbg2 T A 17: 56,849,791 I416F probably damaging Het
Adam6b G A 12: 113,490,939 D459N possibly damaging Het
Adprh A T 16: 38,445,924 D285E probably damaging Het
Aggf1 A T 13: 95,370,942 C112S probably benign Het
Als2cl T C 9: 110,894,034 V602A probably benign Het
Angptl2 G T 2: 33,228,885 V224F probably benign Het
Ap3b2 A T 7: 81,478,077 probably null Het
Aqp2 A C 15: 99,583,842 I206L probably benign Het
Asap2 A G 12: 21,265,997 D930G probably damaging Het
Cacna1e T A 1: 154,477,779 M682L probably benign Het
Ccdc18 A G 5: 108,212,188 N1146S probably benign Het
Ccr4 G A 9: 114,492,005 H331Y probably benign Het
Cd33 A G 7: 43,532,106 L210P probably damaging Het
Cep85l T C 10: 53,301,584 E351G probably damaging Het
Cntn6 C A 6: 104,848,100 T867K probably damaging Het
Cpeb2 C T 5: 43,285,875 R970C probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dscaml1 T A 9: 45,749,440 I1693K possibly damaging Het
Ebf4 A T 2: 130,365,498 M621L probably benign Het
Elp4 G T 2: 105,794,609 T313N probably benign Het
Epas1 T A 17: 86,824,490 I373N possibly damaging Het
Etnk1 A T 6: 143,180,641 M71L probably benign Het
Fry C T 5: 150,404,966 T1257I probably benign Het
Gm21834 A G 17: 57,741,951 F90S possibly damaging Het
Gm8674 T A 13: 49,900,003 noncoding transcript Het
Gna11 T C 10: 81,533,328 T134A probably benign Het
Golga5 C T 12: 102,474,720 S238F probably damaging Het
Grin2a T A 16: 9,579,203 N1007Y probably damaging Het
Hist1h3e A G 13: 23,562,164 F68L probably damaging Het
Ifnar2 G A 16: 91,399,265 V253M possibly damaging Het
Insl5 A T 4: 103,018,185 S123T probably damaging Het
Itgb2 T C 10: 77,559,486 S474P probably benign Het
Kcnb2 A G 1: 15,710,788 H628R probably benign Het
L3mbtl2 G A 15: 81,682,151 D392N probably null Het
Lrp1b G T 2: 41,123,712 T1813K probably damaging Het
Map3k4 A G 17: 12,235,906 L1399P probably damaging Het
Mbtps1 A C 8: 119,546,247 probably null Het
Mettl25 A T 10: 105,826,120 S330T probably benign Het
Mical2 T C 7: 112,309,468 L211P probably damaging Het
Mmrn1 T A 6: 60,945,118 S186R probably damaging Het
Mob3b C A 4: 35,084,046 V48L possibly damaging Het
Mpp6 A G 6: 50,198,326 Y539C probably damaging Het
Napsa A T 7: 44,581,689 H114L probably damaging Het
Nsmce4a A T 7: 130,545,893 probably null Het
Nup62 A G 7: 44,829,929 K456R possibly damaging Het
Nwd2 T A 5: 63,806,975 W1301R probably damaging Het
Olfr1141 A G 2: 87,753,318 V225A probably damaging Het
Olfr118 A T 17: 37,672,251 E76V probably damaging Het
Olfr15 T A 16: 3,839,832 N286K probably damaging Het
Olfr364-ps1 T A 2: 37,146,966 S251R probably damaging Het
Oprm1 G T 10: 6,788,960 W29L probably damaging Het
Pcnt T G 10: 76,389,387 N1761T probably benign Het
Pcnt C T 10: 76,401,386 M1355I probably benign Het
Pde11a A T 2: 76,046,855 S757T probably benign Het
Pde6a T A 18: 61,257,045 I490N possibly damaging Het
Pgap1 A G 1: 54,492,090 V742A probably benign Het
Pkd1l1 A G 11: 8,874,179 C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Plxnb2 C T 15: 89,165,921 C491Y probably damaging Het
Ppt1 C A 4: 122,857,609 H300N probably benign Het
Prpf3 T A 3: 95,836,470 Q457L probably benign Het
Ranbp17 C T 11: 33,264,672 V914I probably benign Het
Rasal2 T C 1: 157,175,851 I413V possibly damaging Het
Rb1cc1 G A 1: 6,244,249 V382I possibly damaging Het
Rere T A 4: 150,615,942 F1125I probably damaging Het
Rprd2 A T 3: 95,765,676 V805E possibly damaging Het
Sept10 T G 10: 59,166,606 E162A probably damaging Het
Sept12 G T 16: 4,992,295 D125E probably benign Het
Serpina6 A G 12: 103,654,473 Y6H probably benign Het
Serpinb3c T C 1: 107,272,787 M209V probably damaging Het
Slc2a7 A T 4: 150,168,471 T523S probably damaging Het
Smdt1 T C 15: 82,346,175 V31A possibly damaging Het
Snrnp48 T C 13: 38,220,704 I245T probably damaging Het
Spink2 G A 5: 77,206,965 T33I probably damaging Het
Sptan1 A G 2: 30,027,127 T2204A probably damaging Het
Synj2 A G 17: 6,025,017 D306G probably benign Het
Tas2r109 A G 6: 132,980,910 I19T possibly damaging Het
Tbk1 C T 10: 121,559,935 V418M probably benign Het
Tcerg1 A G 18: 42,553,430 E684G probably damaging Het
Tenm2 T C 11: 36,300,220 N308S probably damaging Het
Tfb2m A T 1: 179,537,861 probably null Het
Tmc1 T A 19: 20,816,122 L558F probably damaging Het
Tmprss5 T A 9: 49,109,134 I80N possibly damaging Het
Trappc2l G A 8: 122,615,407 V131M probably damaging Het
Trpm7 A C 2: 126,822,599 Y953* probably null Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a6b G A 1: 88,107,261 G107D probably benign Het
Vmn1r197 A T 13: 22,328,350 Y147F probably benign Het
Zfp507 A T 7: 35,794,801 N272K possibly damaging Het
Zfp526 G A 7: 25,226,262 E649K probably benign Het
Zswim6 G A 13: 107,727,234 noncoding transcript Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7914:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7994:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense not run
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGCCTAAGGGAGACTCTGTC -3'
(R):5'- CGTTTCAGGAGAAAGCGCACCAAG -3'

Sequencing Primer
(F):5'- TAAGAACTGCCCTCCAGGAGAG -3'
(R):5'- AGGGGCTATCCAGGTAGCAC -3'
Posted On2014-04-13