Mutagenetix > Incidental Mutation

Incidental Mutation 'R1542:Rasal2'

171781

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

039581-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157175851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 413 (I413V)

Ref Sequence

ENSEMBL: ENSMUSP00000114964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543] [ENSMUST00000143358]

AlphaFold

E9PW37

Predicted Effect

probably benign
Transcript: ENSMUST00000078308
AA Change: I431V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: I431V

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128538

Predicted Effect

probably benign
Transcript: ENSMUST00000129880

SMART Domains

Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
PH	128	243	8.46e-3	SMART
Pfam:C2	252	323	1.7e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132699
AA Change: I413V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: I413V

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134543

SMART Domains

Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
PH	45	160	8.46e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143358

SMART Domains

Protein: ENSMUSP00000116974
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
Blast:PH	1	147	2e-83	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	splice site	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157299235	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	157164670	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157243584	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	157157381	missense	probably damaging	0.99
R8517:Rasal2	UTSW	1	157146279	critical splice acceptor site	probably null
R9021:Rasal2	UTSW	1	157230944	missense	unknown
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAACTGCATCCATGTTACCTACC -3'
(R):5'- GCGAACTGTGCCTTGATGATACCC -3'

Sequencing Primer
(F):5'- GATCTGCAAACAGGCTTTCTTAACTC -3'
(R):5'- ACCTCTTCATAGCATCACGG -3'

Posted On

2014-04-13