Mutagenetix > Incidental Mutations

Incidental Mutation 'R1542:Sptan1'

171783

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

039581-MU

Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29965560-30031451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30027127 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2204 (T2204A)

Ref Sequence

ENSEMBL: ENSMUSP00000047792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046257
AA Change: T2204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: T2204A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095083
AA Change: T2224A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: T2224A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100225
AA Change: T2229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: T2229A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113711

SMART Domains

Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715

Domain	Start	End	E-Value	Type
low complexity region	11	36	N/A	INTRINSIC
low complexity region	90	100	N/A	INTRINSIC
Blast:WD40	146	200	3e-28	BLAST
WD40	207	247	2e-1	SMART
WD40	256	300	3.42e1	SMART
Blast:WD40	323	364	8e-10	BLAST
WD40	382	422	1.66e-5	SMART
WD40	425	465	3.09e-1	SMART
WD40	470	512	4.18e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113717
AA Change: T2209A

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: T2209A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113719
AA Change: T2209A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: T2209A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124494

Predicted Effect

unknown
Transcript: ENSMUST00000129241
AA Change: T2229A

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: T2229A

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139145

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149846

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152453

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201758

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29993956	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	30015610	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	30000071	splice site	probably benign
IGL01070:Sptan1	APN	2	30014173	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	30026114	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	30018479	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	30018489	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	30019968	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	30013713	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	30030324	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	30030740	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	30016055	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	30018474	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29998183	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29978576	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29996043	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29991033	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29986493	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	30025581	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0094:Sptan1	UTSW	2	30006623	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	30010692	splice site	probably benign
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29992752	splice site	probably null
R0368:Sptan1	UTSW	2	29993915	missense	probably benign	0.29
R0396:Sptan1	UTSW	2	29991033	missense	probably damaging	1.00
R0423:Sptan1	UTSW	2	30028672	missense	probably null
R0448:Sptan1	UTSW	2	30026810	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	30013848	splice site	probably benign
R0580:Sptan1	UTSW	2	30007575	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	30013518	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29980063	splice site	probably null
R1352:Sptan1	UTSW	2	30021187	splice site	probably benign
R1456:Sptan1	UTSW	2	29980203	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	30026022	missense	possibly damaging	0.95
R1612:Sptan1	UTSW	2	30003336	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29986420	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29992001	splice site	probably benign
R1879:Sptan1	UTSW	2	29995528	missense	probably damaging	1.00
R1893:Sptan1	UTSW	2	30020460	missense	probably damaging	0.98
R1914:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	30007561	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	30002238	missense	probably benign
R2103:Sptan1	UTSW	2	30030471	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	30018576	splice site	probably benign
R2931:Sptan1	UTSW	2	30018488	missense	probably benign
R3726:Sptan1	UTSW	2	30018419	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	30030025	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	30026588	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	30025569	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	30029709	intron	probably benign
R4718:Sptan1	UTSW	2	30031062	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29996435	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	30011042	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29978443	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29993724	intron	probably benign
R5181:Sptan1	UTSW	2	29993724	intron	probably benign
R5383:Sptan1	UTSW	2	30011328	missense	probably damaging	1.00
R5573:Sptan1	UTSW	2	29986492	nonsense	probably null
R5592:Sptan1	UTSW	2	29986719	intron	probably benign
R5639:Sptan1	UTSW	2	29990993	nonsense	probably null
R5801:Sptan1	UTSW	2	30030601	splice site	probably null
R5947:Sptan1	UTSW	2	29994367	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29996782	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29993887	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	30004523	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	30007549	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	30018515	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	30030973	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29983209	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	30002299	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29986929	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29980197	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	30000056	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	30021307	missense	probably damaging	1.00
R8051:Sptan1	UTSW	2	30030159	missense	probably damaging	1.00
R8055:Sptan1	UTSW	2	29994339	missense	probably benign	0.22
R8103:Sptan1	UTSW	2	30020043	missense	probably damaging	1.00
R8283:Sptan1	UTSW	2	29980200	missense	probably damaging	1.00
R8507:Sptan1	UTSW	2	30026584	missense	probably damaging	1.00
X0028:Sptan1	UTSW	2	30020030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACCATGTTATGCTGAGCCCATC -3'
(R):5'- TGCAGAGCCCGCTATTGCTATTG -3'

Sequencing Primer
(F):5'- TATGCTGAGCCCATCTGAGG -3'
(R):5'- aatggcacaaataaatatgaaccaag -3'

Posted On

2014-04-13