Incidental Mutation 'R1542:Sptan1'
ID171783
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Namespectrin alpha, non-erythrocytic 1
Synonymsalpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 039581-MU
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1542 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29965560-30031451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30027127 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2204 (T2204A)
Ref Sequence ENSEMBL: ENSMUSP00000047792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably damaging
Transcript: ENSMUST00000046257
AA Change: T2204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: T2204A

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: T2224A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: T2224A

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100225
AA Change: T2229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: T2229A

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113711
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113717
AA Change: T2209A

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: T2209A

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113719
AA Change: T2209A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: T2209A

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124494
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: T2229A
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: T2229A

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201758
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,406 M208T possibly damaging Het
Acsbg2 T A 17: 56,849,791 I416F probably damaging Het
Adam6b G A 12: 113,490,939 D459N possibly damaging Het
Adprh A T 16: 38,445,924 D285E probably damaging Het
Aggf1 A T 13: 95,370,942 C112S probably benign Het
Als2cl T C 9: 110,894,034 V602A probably benign Het
Angptl2 G T 2: 33,228,885 V224F probably benign Het
Ap3b2 A T 7: 81,478,077 probably null Het
Aqp2 A C 15: 99,583,842 I206L probably benign Het
Asap2 A G 12: 21,265,997 D930G probably damaging Het
Cacna1e T A 1: 154,477,779 M682L probably benign Het
Ccdc18 A G 5: 108,212,188 N1146S probably benign Het
Ccr4 G A 9: 114,492,005 H331Y probably benign Het
Cd33 A G 7: 43,532,106 L210P probably damaging Het
Cep85l T C 10: 53,301,584 E351G probably damaging Het
Cntn6 C A 6: 104,848,100 T867K probably damaging Het
Cpeb2 C T 5: 43,285,875 R970C probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dscaml1 T A 9: 45,749,440 I1693K possibly damaging Het
Ebf4 A T 2: 130,365,498 M621L probably benign Het
Elp4 G T 2: 105,794,609 T313N probably benign Het
Epas1 T A 17: 86,824,490 I373N possibly damaging Het
Etnk1 A T 6: 143,180,641 M71L probably benign Het
Fry C T 5: 150,404,966 T1257I probably benign Het
Gm21834 A G 17: 57,741,951 F90S possibly damaging Het
Gm8674 T A 13: 49,900,003 noncoding transcript Het
Gna11 T C 10: 81,533,328 T134A probably benign Het
Golga5 C T 12: 102,474,720 S238F probably damaging Het
Grin2a T A 16: 9,579,203 N1007Y probably damaging Het
Hist1h3e A G 13: 23,562,164 F68L probably damaging Het
Ifnar2 G A 16: 91,399,265 V253M possibly damaging Het
Insl5 A T 4: 103,018,185 S123T probably damaging Het
Itgb2 T C 10: 77,559,486 S474P probably benign Het
Kcnb2 A G 1: 15,710,788 H628R probably benign Het
L3mbtl2 G A 15: 81,682,151 D392N probably null Het
Lrp1b G T 2: 41,123,712 T1813K probably damaging Het
Map3k4 A G 17: 12,235,906 L1399P probably damaging Het
Mbtps1 A C 8: 119,546,247 probably null Het
Mettl25 A T 10: 105,826,120 S330T probably benign Het
Mical2 T C 7: 112,309,468 L211P probably damaging Het
Mmrn1 T A 6: 60,945,118 S186R probably damaging Het
Mob3b C A 4: 35,084,046 V48L possibly damaging Het
Mpp6 A G 6: 50,198,326 Y539C probably damaging Het
Napsa A T 7: 44,581,689 H114L probably damaging Het
Nsmce4a A T 7: 130,545,893 probably null Het
Nup62 A G 7: 44,829,929 K456R possibly damaging Het
Nwd2 T A 5: 63,806,975 W1301R probably damaging Het
Olfr1141 A G 2: 87,753,318 V225A probably damaging Het
Olfr118 A T 17: 37,672,251 E76V probably damaging Het
Olfr15 T A 16: 3,839,832 N286K probably damaging Het
Olfr364-ps1 T A 2: 37,146,966 S251R probably damaging Het
Oprm1 G T 10: 6,788,960 W29L probably damaging Het
Pcnt T G 10: 76,389,387 N1761T probably benign Het
Pcnt C T 10: 76,401,386 M1355I probably benign Het
Pde11a A T 2: 76,046,855 S757T probably benign Het
Pde6a T A 18: 61,257,045 I490N possibly damaging Het
Pgap1 A G 1: 54,492,090 V742A probably benign Het
Pik3c2b T C 1: 133,090,034 L915P probably damaging Het
Pkd1l1 A G 11: 8,874,179 C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Plxnb2 C T 15: 89,165,921 C491Y probably damaging Het
Ppt1 C A 4: 122,857,609 H300N probably benign Het
Prpf3 T A 3: 95,836,470 Q457L probably benign Het
Ranbp17 C T 11: 33,264,672 V914I probably benign Het
Rasal2 T C 1: 157,175,851 I413V possibly damaging Het
Rb1cc1 G A 1: 6,244,249 V382I possibly damaging Het
Rere T A 4: 150,615,942 F1125I probably damaging Het
Rprd2 A T 3: 95,765,676 V805E possibly damaging Het
Sept10 T G 10: 59,166,606 E162A probably damaging Het
Sept12 G T 16: 4,992,295 D125E probably benign Het
Serpina6 A G 12: 103,654,473 Y6H probably benign Het
Serpinb3c T C 1: 107,272,787 M209V probably damaging Het
Slc2a7 A T 4: 150,168,471 T523S probably damaging Het
Smdt1 T C 15: 82,346,175 V31A possibly damaging Het
Snrnp48 T C 13: 38,220,704 I245T probably damaging Het
Spink2 G A 5: 77,206,965 T33I probably damaging Het
Synj2 A G 17: 6,025,017 D306G probably benign Het
Tas2r109 A G 6: 132,980,910 I19T possibly damaging Het
Tbk1 C T 10: 121,559,935 V418M probably benign Het
Tcerg1 A G 18: 42,553,430 E684G probably damaging Het
Tenm2 T C 11: 36,300,220 N308S probably damaging Het
Tfb2m A T 1: 179,537,861 probably null Het
Tmc1 T A 19: 20,816,122 L558F probably damaging Het
Tmprss5 T A 9: 49,109,134 I80N possibly damaging Het
Trappc2l G A 8: 122,615,407 V131M probably damaging Het
Trpm7 A C 2: 126,822,599 Y953* probably null Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a6b G A 1: 88,107,261 G107D probably benign Het
Vmn1r197 A T 13: 22,328,350 Y147F probably benign Het
Zfp507 A T 7: 35,794,801 N272K possibly damaging Het
Zfp526 G A 7: 25,226,262 E649K probably benign Het
Zswim6 G A 13: 107,727,234 noncoding transcript Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0396:Sptan1 UTSW 2 29991033 missense probably damaging 1.00
R0423:Sptan1 UTSW 2 30028672 missense probably null
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1537:Sptan1 UTSW 2 30026022 missense possibly damaging 0.95
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30020460 missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29983209 missense probably benign 0.02
R7248:Sptan1 UTSW 2 30002299 missense probably benign 0.10
R7282:Sptan1 UTSW 2 29986929 missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29980197 missense probably damaging 1.00
R7585:Sptan1 UTSW 2 30000056 missense probably benign 0.06
R7779:Sptan1 UTSW 2 30021307 missense probably damaging 1.00
R8051:Sptan1 UTSW 2 30030159 missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29994339 missense probably benign 0.22
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCATGTTATGCTGAGCCCATC -3'
(R):5'- TGCAGAGCCCGCTATTGCTATTG -3'

Sequencing Primer
(F):5'- TATGCTGAGCCCATCTGAGG -3'
(R):5'- aatggcacaaataaatatgaaccaag -3'
Posted On2014-04-13