Incidental Mutation 'R1542:Trpm7'
ID 171791
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Name transient receptor potential cation channel, subfamily M, member 7
Synonyms CHAK, 5033407O22Rik, TRP-PLIK, 4833414K03Rik, CHAK1, LTRPC7, Ltpr7, 2310022G15Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 126633485-126718150 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 126664519 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 953 (Y953*)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
AlphaFold Q923J1
PDB Structure CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028843
AA Change: Y953*
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: Y953*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103224
AA Change: Y953*
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: Y953*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142334
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126,670,951 (GRCm39) missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126,687,992 (GRCm39) critical splice donor site probably null
IGL01634:Trpm7 APN 2 126,668,738 (GRCm39) missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126,658,719 (GRCm39) missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126,655,104 (GRCm39) missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126,639,863 (GRCm39) missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126,641,163 (GRCm39) unclassified probably benign
IGL02172:Trpm7 APN 2 126,637,248 (GRCm39) missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126,649,282 (GRCm39) missense probably benign
IGL02375:Trpm7 APN 2 126,667,664 (GRCm39) missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126,661,811 (GRCm39) missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126,682,699 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126,688,079 (GRCm39) missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126,649,207 (GRCm39) critical splice donor site probably null
Accused UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
Condemned UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
denounced UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
deposed UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
Summac UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
Vacated UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126,658,677 (GRCm39) splice site probably benign
R0038:Trpm7 UTSW 2 126,637,388 (GRCm39) missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126,654,691 (GRCm39) missense probably benign
R0165:Trpm7 UTSW 2 126,639,433 (GRCm39) missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126,668,638 (GRCm39) nonsense probably null
R0543:Trpm7 UTSW 2 126,690,449 (GRCm39) missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126,687,992 (GRCm39) critical splice donor site probably null
R0844:Trpm7 UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126,641,159 (GRCm39) splice site probably null
R0919:Trpm7 UTSW 2 126,673,158 (GRCm39) missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126,646,969 (GRCm39) missense probably benign
R1109:Trpm7 UTSW 2 126,639,713 (GRCm39) missense probably benign 0.01
R1118:Trpm7 UTSW 2 126,664,406 (GRCm39) missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126,667,374 (GRCm39) nonsense probably null
R1527:Trpm7 UTSW 2 126,672,082 (GRCm39) missense probably benign 0.18
R1882:Trpm7 UTSW 2 126,654,697 (GRCm39) missense probably benign 0.00
R1951:Trpm7 UTSW 2 126,673,219 (GRCm39) missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2012:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2026:Trpm7 UTSW 2 126,654,658 (GRCm39) missense probably benign 0.39
R2067:Trpm7 UTSW 2 126,639,647 (GRCm39) missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126,700,329 (GRCm39) splice site probably benign
R3082:Trpm7 UTSW 2 126,686,342 (GRCm39) missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126,668,630 (GRCm39) splice site probably benign
R3607:Trpm7 UTSW 2 126,638,348 (GRCm39) intron probably benign
R3739:Trpm7 UTSW 2 126,693,441 (GRCm39) missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126,673,138 (GRCm39) missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126,658,751 (GRCm39) missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126,671,083 (GRCm39) missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126,690,458 (GRCm39) missense probably damaging 1.00
R4392:Trpm7 UTSW 2 126,637,429 (GRCm39) splice site probably null
R4404:Trpm7 UTSW 2 126,675,635 (GRCm39) missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126,639,131 (GRCm39) missense probably benign 0.01
R4714:Trpm7 UTSW 2 126,682,703 (GRCm39) nonsense probably null
R4807:Trpm7 UTSW 2 126,673,149 (GRCm39) missense probably benign 0.00
R4815:Trpm7 UTSW 2 126,700,412 (GRCm39) missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126,655,105 (GRCm39) missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126,665,978 (GRCm39) missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126,638,256 (GRCm39) critical splice donor site probably null
R5263:Trpm7 UTSW 2 126,663,137 (GRCm39) missense probably benign 0.34
R5361:Trpm7 UTSW 2 126,671,161 (GRCm39) missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126,684,775 (GRCm39) critical splice donor site probably null
R5574:Trpm7 UTSW 2 126,654,950 (GRCm39) missense probably benign
R5782:Trpm7 UTSW 2 126,639,634 (GRCm39) missense probably benign 0.04
R5840:Trpm7 UTSW 2 126,664,531 (GRCm39) nonsense probably null
R6044:Trpm7 UTSW 2 126,656,665 (GRCm39) missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126,679,301 (GRCm39) missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126,667,559 (GRCm39) missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126,649,214 (GRCm39) missense probably benign
R6530:Trpm7 UTSW 2 126,654,631 (GRCm39) missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126,686,340 (GRCm39) missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
R6868:Trpm7 UTSW 2 126,679,334 (GRCm39) missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126,668,685 (GRCm39) missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126,641,126 (GRCm39) missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126,673,115 (GRCm39) critical splice donor site probably null
R7509:Trpm7 UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126,652,085 (GRCm39) missense probably benign
R7774:Trpm7 UTSW 2 126,655,158 (GRCm39) missense probably benign 0.09
R7793:Trpm7 UTSW 2 126,665,995 (GRCm39) nonsense probably null
R7812:Trpm7 UTSW 2 126,641,236 (GRCm39) missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
R7951:Trpm7 UTSW 2 126,655,188 (GRCm39) missense possibly damaging 0.94
R7965:Trpm7 UTSW 2 126,667,614 (GRCm39) missense probably damaging 0.99
R7992:Trpm7 UTSW 2 126,667,454 (GRCm39) missense probably benign
R8034:Trpm7 UTSW 2 126,688,119 (GRCm39) missense probably damaging 0.98
R8199:Trpm7 UTSW 2 126,691,918 (GRCm39) missense probably damaging 1.00
R8304:Trpm7 UTSW 2 126,639,797 (GRCm39) missense probably damaging 1.00
R8405:Trpm7 UTSW 2 126,658,755 (GRCm39) missense probably benign 0.26
R8674:Trpm7 UTSW 2 126,641,086 (GRCm39) unclassified probably benign
R8742:Trpm7 UTSW 2 126,667,469 (GRCm39) missense probably damaging 1.00
R8754:Trpm7 UTSW 2 126,664,623 (GRCm39) missense probably damaging 1.00
R8842:Trpm7 UTSW 2 126,663,131 (GRCm39) missense probably benign 0.05
R8850:Trpm7 UTSW 2 126,652,100 (GRCm39) missense probably benign 0.00
R8881:Trpm7 UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
R8898:Trpm7 UTSW 2 126,664,661 (GRCm39) missense possibly damaging 0.92
R9339:Trpm7 UTSW 2 126,665,906 (GRCm39) missense probably benign 0.04
R9428:Trpm7 UTSW 2 126,671,140 (GRCm39) missense probably damaging 1.00
R9446:Trpm7 UTSW 2 126,672,185 (GRCm39) critical splice acceptor site probably null
R9568:Trpm7 UTSW 2 126,664,510 (GRCm39) missense probably benign 0.02
R9647:Trpm7 UTSW 2 126,667,562 (GRCm39) missense probably damaging 1.00
R9678:Trpm7 UTSW 2 126,686,290 (GRCm39) missense probably damaging 1.00
R9746:Trpm7 UTSW 2 126,664,578 (GRCm39) missense possibly damaging 0.47
X0026:Trpm7 UTSW 2 126,671,210 (GRCm39) missense probably benign
Z1088:Trpm7 UTSW 2 126,639,201 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCAATAGAAATTTGTGGGGCCAG -3'
(R):5'- CTGCCTTTAGTGGAGAGGAAGATTGC -3'

Sequencing Primer
(F):5'- TTGTGGGGCCAGGTAAAGC -3'
(R):5'- GACATCTTTGGAATGTGCTACC -3'
Posted On 2014-04-13