Mutagenetix > Incidental Mutation

Incidental Mutation 'R1542:Trpm7'

171791

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

039581-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 126822599 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 953 (Y953*)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

AlphaFold

Q923J1

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000028843
AA Change: Y953*

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: Y953*

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000103224
AA Change: Y953*

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: Y953*

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142334

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
denounced	UTSW	2	126813021	missense	probably benign	0.00
deposed	UTSW	2	126797498	missense	probably benign	0.01
Summac	UTSW	2	126819963	missense	probably damaging	1.00
Vacated	UTSW	2	126849922	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
R8674:Trpm7	UTSW	2	126799166	unclassified	probably benign
R8742:Trpm7	UTSW	2	126825549	missense	probably damaging	1.00
R8754:Trpm7	UTSW	2	126822703	missense	probably damaging	1.00
R8842:Trpm7	UTSW	2	126821211	missense	probably benign	0.05
R8850:Trpm7	UTSW	2	126810180	missense	probably benign	0.00
R8881:Trpm7	UTSW	2	126819963	missense	probably damaging	1.00
R8898:Trpm7	UTSW	2	126822741	missense	possibly damaging	0.92
R9339:Trpm7	UTSW	2	126823986	missense	probably benign	0.04
R9428:Trpm7	UTSW	2	126829220	missense	probably damaging	1.00
R9446:Trpm7	UTSW	2	126830265	critical splice acceptor site	probably null
R9568:Trpm7	UTSW	2	126822590	missense	probably benign	0.02
R9647:Trpm7	UTSW	2	126825642	missense	probably damaging	1.00
R9678:Trpm7	UTSW	2	126844370	missense	probably damaging	1.00
R9746:Trpm7	UTSW	2	126822658	missense	possibly damaging	0.47
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACCAATAGAAATTTGTGGGGCCAG -3'
(R):5'- CTGCCTTTAGTGGAGAGGAAGATTGC -3'

Sequencing Primer
(F):5'- TTGTGGGGCCAGGTAAAGC -3'
(R):5'- GACATCTTTGGAATGTGCTACC -3'

Posted On

2014-04-13