Incidental Mutation 'R1542:Rprd2'
ID 171794
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Name regulation of nuclear pre-mRNA domain containing 2
Synonyms 2810036A19Rik, 6720469I21Rik, 4930535B03Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.745) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 95667653-95726175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95672988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 805 (V805E)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
AlphaFold Q6NXI6
Predicted Effect possibly damaging
Transcript: ENSMUST00000090791
AA Change: V805E

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: V805E

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198740
Predicted Effect unknown
Transcript: ENSMUST00000200164
AA Change: V721E
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95,672,691 (GRCm39) missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95,672,421 (GRCm39) missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95,692,416 (GRCm39) missense probably benign 0.05
IGL01022:Rprd2 APN 3 95,671,066 (GRCm39) nonsense probably null
IGL01121:Rprd2 APN 3 95,683,862 (GRCm39) missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95,683,859 (GRCm39) missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95,672,631 (GRCm39) missense probably benign
IGL01414:Rprd2 APN 3 95,672,837 (GRCm39) missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95,672,815 (GRCm39) missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95,694,622 (GRCm39) missense probably benign 0.17
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95,681,669 (GRCm39) missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95,673,699 (GRCm39) missense probably benign 0.30
R0847:Rprd2 UTSW 3 95,672,725 (GRCm39) missense probably benign 0.00
R0942:Rprd2 UTSW 3 95,672,730 (GRCm39) missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95,691,559 (GRCm39) missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95,673,216 (GRCm39) missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95,725,888 (GRCm39) missense possibly damaging 0.57
R1577:Rprd2 UTSW 3 95,672,047 (GRCm39) missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95,726,051 (GRCm39) unclassified probably benign
R1640:Rprd2 UTSW 3 95,671,059 (GRCm39) unclassified probably benign
R1670:Rprd2 UTSW 3 95,672,115 (GRCm39) missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95,672,107 (GRCm39) nonsense probably null
R2966:Rprd2 UTSW 3 95,673,745 (GRCm39) splice site probably null
R3612:Rprd2 UTSW 3 95,671,464 (GRCm39) missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95,671,872 (GRCm39) missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95,672,536 (GRCm39) missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95,694,686 (GRCm39) missense probably benign 0.41
R4783:Rprd2 UTSW 3 95,681,645 (GRCm39) missense probably benign 0.03
R4832:Rprd2 UTSW 3 95,681,483 (GRCm39) missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95,671,849 (GRCm39) missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95,673,661 (GRCm39) missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5134:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5244:Rprd2 UTSW 3 95,697,494 (GRCm39) missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95,671,401 (GRCm39) missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95,692,371 (GRCm39) missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95,672,175 (GRCm39) missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95,694,685 (GRCm39) missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95,687,753 (GRCm39) missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95,673,399 (GRCm39) missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95,681,531 (GRCm39) missense probably benign 0.00
R7064:Rprd2 UTSW 3 95,672,328 (GRCm39) missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95,684,022 (GRCm39) missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95,673,087 (GRCm39) missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95,683,899 (GRCm39) missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95,684,105 (GRCm39) missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95,691,613 (GRCm39) missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95,671,367 (GRCm39) missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95,687,896 (GRCm39) missense probably damaging 0.99
R9030:Rprd2 UTSW 3 95,691,622 (GRCm39) missense probably benign 0.15
R9623:Rprd2 UTSW 3 95,679,505 (GRCm39) missense probably benign 0.30
RF034:Rprd2 UTSW 3 95,673,632 (GRCm39) small deletion probably benign
RF056:Rprd2 UTSW 3 95,673,631 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAGGCACCAAATAGCCCAGG -3'
(R):5'- ACACCCACCCAGGATGAGATGATG -3'

Sequencing Primer
(F):5'- GACGGTCACAGTTCTCACTAGAG -3'
(R):5'- TGATGGATAAGCCCACATCCAG -3'
Posted On 2014-04-13