Mutagenetix > Incidental Mutation

Incidental Mutation 'R1542:Slc2a7'

171800

Institutional Source

Beutler Lab

Gene Symbol

Slc2a7

Ensembl Gene

ENSMUSG00000062064

Gene Name

solute carrier family 2 (facilitated glucose transporter), member 7

Synonyms

OTTMUSG00000010396

MMRRC Submission

039581-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150148972-150168482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 150168471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 523 (T523S)

Ref Sequence

ENSEMBL: ENSMUSP00000059106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059893]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000059893
AA Change: T523S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000059106
Gene: ENSMUSG00000062064
AA Change: T523S

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	319	2e-15	PFAM
Pfam:Sugar_tr	26	494	7.6e-120	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A7 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Li et al., 2004). This family of transporters shows conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Slc2a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Slc2a7	APN	4	150157564	missense	probably damaging	1.00
IGL01990:Slc2a7	APN	4	150154684	missense	possibly damaging	0.89
IGL02480:Slc2a7	APN	4	150160112	missense	possibly damaging	0.93
IGL02607:Slc2a7	APN	4	150154705	missense	probably benign
IGL02716:Slc2a7	APN	4	150160010	splice site	probably benign
IGL02861:Slc2a7	APN	4	150168379	missense	probably benign	0.16
IGL03343:Slc2a7	APN	4	150168340	missense	probably damaging	1.00
anhedonic	UTSW	4	150158558	nonsense	probably null
Anorectic	UTSW	4	150158210	splice site	probably null
paunch	UTSW	4	150158148	missense	probably damaging	1.00
tablemuscle	UTSW	4	150168340	missense	probably damaging	1.00
R0116:Slc2a7	UTSW	4	150168264	missense	probably benign	0.31
R0302:Slc2a7	UTSW	4	150149521	missense	probably damaging	0.99
R0309:Slc2a7	UTSW	4	150158071	splice site	probably benign
R0367:Slc2a7	UTSW	4	150166366	missense	probably benign	0.03
R1485:Slc2a7	UTSW	4	150166396	missense	probably damaging	1.00
R1544:Slc2a7	UTSW	4	150154686	missense	probably damaging	1.00
R3973:Slc2a7	UTSW	4	150158210	splice site	probably null
R4399:Slc2a7	UTSW	4	150158550	missense	probably damaging	1.00
R4467:Slc2a7	UTSW	4	150163274	missense	possibly damaging	0.95
R4712:Slc2a7	UTSW	4	150168469	missense	probably benign	0.00
R5066:Slc2a7	UTSW	4	150160116	missense	probably damaging	1.00
R5510:Slc2a7	UTSW	4	150160094	missense	probably benign	0.00
R5995:Slc2a7	UTSW	4	150168340	missense	probably damaging	1.00
R6017:Slc2a7	UTSW	4	150165172	missense	probably damaging	0.99
R6062:Slc2a7	UTSW	4	150168427	missense	probably benign
R6185:Slc2a7	UTSW	4	150148993	missense	probably benign	0.00
R6730:Slc2a7	UTSW	4	150158148	missense	probably damaging	1.00
R7753:Slc2a7	UTSW	4	150154684	missense	possibly damaging	0.89
R8145:Slc2a7	UTSW	4	150168361	missense	probably damaging	1.00
R8203:Slc2a7	UTSW	4	150158558	nonsense	probably null
R8512:Slc2a7	UTSW	4	150163295	missense	probably benign	0.23
R9066:Slc2a7	UTSW	4	150166415	missense	probably damaging	1.00
R9074:Slc2a7	UTSW	4	150158168	missense	probably benign	0.44
R9129:Slc2a7	UTSW	4	150158544	missense	probably benign	0.31
R9773:Slc2a7	UTSW	4	150149587	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GCCATGAAGAAAGTCCCTGTGACTC -3'
(R):5'- TGTTTAGCCTTGAAGCCAACACCC -3'

Sequencing Primer
(F):5'- CAAAGGCACCAAGTGTATTGTCTG -3'
(R):5'- CTGCCAAGTAAACCGGGG -3'

Posted On

2014-04-13