Incidental Mutation 'R1542:Slc2a7'
ID 171800
Institutional Source Beutler Lab
Gene Symbol Slc2a7
Ensembl Gene ENSMUSG00000062064
Gene Name solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms OTTMUSG00000010396
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 150233429-150252939 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 150252928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 523 (T523S)
Ref Sequence ENSEMBL: ENSMUSP00000059106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059893]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000059893
AA Change: T523S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059106
Gene: ENSMUSG00000062064
AA Change: T523S

DomainStartEndE-ValueType
Pfam:MFS_1 22 319 2e-15 PFAM
Pfam:Sugar_tr 26 494 7.6e-120 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A7 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Li et al., 2004). This family of transporters shows conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Slc2a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Slc2a7 APN 4 150,242,021 (GRCm39) missense probably damaging 1.00
IGL01990:Slc2a7 APN 4 150,239,141 (GRCm39) missense possibly damaging 0.89
IGL02480:Slc2a7 APN 4 150,244,569 (GRCm39) missense possibly damaging 0.93
IGL02607:Slc2a7 APN 4 150,239,162 (GRCm39) missense probably benign
IGL02716:Slc2a7 APN 4 150,244,467 (GRCm39) splice site probably benign
IGL02861:Slc2a7 APN 4 150,252,836 (GRCm39) missense probably benign 0.16
IGL03343:Slc2a7 APN 4 150,252,797 (GRCm39) missense probably damaging 1.00
anhedonic UTSW 4 150,243,015 (GRCm39) nonsense probably null
Anorectic UTSW 4 150,242,667 (GRCm39) splice site probably null
paunch UTSW 4 150,242,605 (GRCm39) missense probably damaging 1.00
tablemuscle UTSW 4 150,252,797 (GRCm39) missense probably damaging 1.00
R0116:Slc2a7 UTSW 4 150,252,721 (GRCm39) missense probably benign 0.31
R0302:Slc2a7 UTSW 4 150,233,978 (GRCm39) missense probably damaging 0.99
R0309:Slc2a7 UTSW 4 150,242,528 (GRCm39) splice site probably benign
R0367:Slc2a7 UTSW 4 150,250,823 (GRCm39) missense probably benign 0.03
R1485:Slc2a7 UTSW 4 150,250,853 (GRCm39) missense probably damaging 1.00
R1544:Slc2a7 UTSW 4 150,239,143 (GRCm39) missense probably damaging 1.00
R3973:Slc2a7 UTSW 4 150,242,667 (GRCm39) splice site probably null
R4399:Slc2a7 UTSW 4 150,243,007 (GRCm39) missense probably damaging 1.00
R4467:Slc2a7 UTSW 4 150,247,731 (GRCm39) missense possibly damaging 0.95
R4712:Slc2a7 UTSW 4 150,252,926 (GRCm39) missense probably benign 0.00
R5066:Slc2a7 UTSW 4 150,244,573 (GRCm39) missense probably damaging 1.00
R5510:Slc2a7 UTSW 4 150,244,551 (GRCm39) missense probably benign 0.00
R5995:Slc2a7 UTSW 4 150,252,797 (GRCm39) missense probably damaging 1.00
R6017:Slc2a7 UTSW 4 150,249,629 (GRCm39) missense probably damaging 0.99
R6062:Slc2a7 UTSW 4 150,252,884 (GRCm39) missense probably benign
R6185:Slc2a7 UTSW 4 150,233,450 (GRCm39) missense probably benign 0.00
R6730:Slc2a7 UTSW 4 150,242,605 (GRCm39) missense probably damaging 1.00
R7753:Slc2a7 UTSW 4 150,239,141 (GRCm39) missense possibly damaging 0.89
R8145:Slc2a7 UTSW 4 150,252,818 (GRCm39) missense probably damaging 1.00
R8203:Slc2a7 UTSW 4 150,243,015 (GRCm39) nonsense probably null
R8512:Slc2a7 UTSW 4 150,247,752 (GRCm39) missense probably benign 0.23
R9066:Slc2a7 UTSW 4 150,250,872 (GRCm39) missense probably damaging 1.00
R9074:Slc2a7 UTSW 4 150,242,625 (GRCm39) missense probably benign 0.44
R9129:Slc2a7 UTSW 4 150,243,001 (GRCm39) missense probably benign 0.31
R9773:Slc2a7 UTSW 4 150,234,044 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCCATGAAGAAAGTCCCTGTGACTC -3'
(R):5'- TGTTTAGCCTTGAAGCCAACACCC -3'

Sequencing Primer
(F):5'- CAAAGGCACCAAGTGTATTGTCTG -3'
(R):5'- CTGCCAAGTAAACCGGGG -3'
Posted On 2014-04-13