Incidental Mutation 'R1542:Rere'
ID 171801
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Name arginine glutamic acid dipeptide (RE) repeats
Synonyms eye, eyes3, Atr2, atrophin-2, 1110033A15Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 150366103-150706423 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150700399 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1125 (F1125I)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682] [ENSMUST00000136646]
AlphaFold Q80TZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000105680
AA Change: F857I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: F857I

DomainStartEndE-ValueType
ELM2 18 70 1.67e-13 SMART
SANT 124 173 1.8e-6 SMART
low complexity region 176 193 N/A INTRINSIC
ZnF_GATA 233 284 1.94e-15 SMART
Pfam:Atrophin-1 300 1290 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105682
AA Change: F1125I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: F1125I

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136646
SMART Domains Protein: ENSMUSP00000121544
Gene: ENSMUSG00000039852

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 199 2.2e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137112
Predicted Effect unknown
Transcript: ENSMUST00000219467
AA Change: F140I
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150,703,920 (GRCm39) missense probably damaging 1.00
IGL01465:Rere APN 4 150,594,451 (GRCm39) missense unknown
IGL01523:Rere APN 4 150,700,012 (GRCm39) missense possibly damaging 0.93
IGL01688:Rere APN 4 150,702,893 (GRCm39) missense probably damaging 1.00
IGL02057:Rere APN 4 150,699,289 (GRCm39) unclassified probably benign
IGL02621:Rere APN 4 150,698,269 (GRCm39) unclassified probably benign
IGL02672:Rere APN 4 150,594,483 (GRCm39) missense unknown
R0116:Rere UTSW 4 150,701,433 (GRCm39) missense probably benign 0.18
R0119:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0344:Rere UTSW 4 150,695,438 (GRCm39) unclassified probably benign
R0504:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0630:Rere UTSW 4 150,703,545 (GRCm39) missense probably damaging 1.00
R0961:Rere UTSW 4 150,699,829 (GRCm39) unclassified probably benign
R1164:Rere UTSW 4 150,619,341 (GRCm39) missense unknown
R1424:Rere UTSW 4 150,701,495 (GRCm39) missense probably damaging 1.00
R1652:Rere UTSW 4 150,696,522 (GRCm39) unclassified probably benign
R1953:Rere UTSW 4 150,701,294 (GRCm39) missense probably damaging 1.00
R1959:Rere UTSW 4 150,553,247 (GRCm39) missense probably benign 0.23
R1966:Rere UTSW 4 150,701,330 (GRCm39) missense probably damaging 1.00
R1975:Rere UTSW 4 150,700,190 (GRCm39) missense probably damaging 0.99
R2070:Rere UTSW 4 150,699,047 (GRCm39) unclassified probably benign
R2115:Rere UTSW 4 150,697,018 (GRCm39) unclassified probably benign
R2144:Rere UTSW 4 150,701,388 (GRCm39) missense probably damaging 0.99
R2270:Rere UTSW 4 150,561,837 (GRCm39) missense unknown
R2969:Rere UTSW 4 150,654,673 (GRCm39) missense unknown
R3699:Rere UTSW 4 150,561,819 (GRCm39) critical splice acceptor site probably null
R3723:Rere UTSW 4 150,553,252 (GRCm39) missense probably damaging 1.00
R3826:Rere UTSW 4 150,554,785 (GRCm39) missense probably benign 0.42
R4234:Rere UTSW 4 150,701,862 (GRCm39) missense probably damaging 1.00
R4512:Rere UTSW 4 150,561,909 (GRCm39) missense unknown
R4798:Rere UTSW 4 150,699,624 (GRCm39) unclassified probably benign
R4883:Rere UTSW 4 150,700,510 (GRCm39) missense probably damaging 0.98
R4914:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4916:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4917:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4918:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4966:Rere UTSW 4 150,698,273 (GRCm39) unclassified probably benign
R5172:Rere UTSW 4 150,654,726 (GRCm39) missense unknown
R5643:Rere UTSW 4 150,701,700 (GRCm39) missense probably damaging 1.00
R6058:Rere UTSW 4 150,553,255 (GRCm39) missense probably damaging 1.00
R7112:Rere UTSW 4 150,491,061 (GRCm39) missense probably benign
R7173:Rere UTSW 4 150,553,195 (GRCm39) missense probably damaging 1.00
R7190:Rere UTSW 4 150,695,410 (GRCm39) missense unknown
R7699:Rere UTSW 4 150,701,555 (GRCm39) missense
R7990:Rere UTSW 4 150,699,327 (GRCm39) missense unknown
R8070:Rere UTSW 4 150,701,832 (GRCm39) missense probably damaging 1.00
R8101:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8103:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8215:Rere UTSW 4 150,701,424 (GRCm39) missense possibly damaging 0.95
R8254:Rere UTSW 4 150,697,129 (GRCm39) missense unknown
R8348:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8448:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8725:Rere UTSW 4 150,701,792 (GRCm39) nonsense probably null
R8790:Rere UTSW 4 150,593,332 (GRCm39) missense unknown
R8921:Rere UTSW 4 150,696,471 (GRCm39) missense unknown
R8937:Rere UTSW 4 150,699,331 (GRCm39) unclassified probably benign
R9345:Rere UTSW 4 150,554,770 (GRCm39) missense probably damaging 0.99
R9377:Rere UTSW 4 150,593,342 (GRCm39) missense unknown
R9490:Rere UTSW 4 150,516,040 (GRCm39) missense probably benign 0.16
R9523:Rere UTSW 4 150,703,636 (GRCm39) missense probably damaging 0.98
R9653:Rere UTSW 4 150,516,010 (GRCm39) missense probably benign 0.28
R9657:Rere UTSW 4 150,699,390 (GRCm39) missense unknown
Z1176:Rere UTSW 4 150,553,240 (GRCm39) missense probably damaging 1.00
Z1177:Rere UTSW 4 150,700,268 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCTGCTGTGCAAATCAAGGAGGAG -3'
(R):5'- AGCTGCAAGCAAAGGACCAGTC -3'

Sequencing Primer
(F):5'- CTCTGGATGAAGCTGAGGAGC -3'
(R):5'- ctcccgttcccgctctc -3'
Posted On 2014-04-13