Incidental Mutation 'R1542:Fry'
ID171806
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 039581-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R1542 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150404966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1257 (T1257I)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
AA Change: T1257I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: T1257I

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202630
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,406 M208T possibly damaging Het
Acsbg2 T A 17: 56,849,791 I416F probably damaging Het
Adam6b G A 12: 113,490,939 D459N possibly damaging Het
Adprh A T 16: 38,445,924 D285E probably damaging Het
Aggf1 A T 13: 95,370,942 C112S probably benign Het
Als2cl T C 9: 110,894,034 V602A probably benign Het
Angptl2 G T 2: 33,228,885 V224F probably benign Het
Ap3b2 A T 7: 81,478,077 probably null Het
Aqp2 A C 15: 99,583,842 I206L probably benign Het
Asap2 A G 12: 21,265,997 D930G probably damaging Het
Cacna1e T A 1: 154,477,779 M682L probably benign Het
Ccdc18 A G 5: 108,212,188 N1146S probably benign Het
Ccr4 G A 9: 114,492,005 H331Y probably benign Het
Cd33 A G 7: 43,532,106 L210P probably damaging Het
Cep85l T C 10: 53,301,584 E351G probably damaging Het
Cntn6 C A 6: 104,848,100 T867K probably damaging Het
Cpeb2 C T 5: 43,285,875 R970C probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dscaml1 T A 9: 45,749,440 I1693K possibly damaging Het
Ebf4 A T 2: 130,365,498 M621L probably benign Het
Elp4 G T 2: 105,794,609 T313N probably benign Het
Epas1 T A 17: 86,824,490 I373N possibly damaging Het
Etnk1 A T 6: 143,180,641 M71L probably benign Het
Gm21834 A G 17: 57,741,951 F90S possibly damaging Het
Gm8674 T A 13: 49,900,003 noncoding transcript Het
Gna11 T C 10: 81,533,328 T134A probably benign Het
Golga5 C T 12: 102,474,720 S238F probably damaging Het
Grin2a T A 16: 9,579,203 N1007Y probably damaging Het
Hist1h3e A G 13: 23,562,164 F68L probably damaging Het
Ifnar2 G A 16: 91,399,265 V253M possibly damaging Het
Insl5 A T 4: 103,018,185 S123T probably damaging Het
Itgb2 T C 10: 77,559,486 S474P probably benign Het
Kcnb2 A G 1: 15,710,788 H628R probably benign Het
L3mbtl2 G A 15: 81,682,151 D392N probably null Het
Lrp1b G T 2: 41,123,712 T1813K probably damaging Het
Map3k4 A G 17: 12,235,906 L1399P probably damaging Het
Mbtps1 A C 8: 119,546,247 probably null Het
Mettl25 A T 10: 105,826,120 S330T probably benign Het
Mical2 T C 7: 112,309,468 L211P probably damaging Het
Mmrn1 T A 6: 60,945,118 S186R probably damaging Het
Mob3b C A 4: 35,084,046 V48L possibly damaging Het
Mpp6 A G 6: 50,198,326 Y539C probably damaging Het
Napsa A T 7: 44,581,689 H114L probably damaging Het
Nsmce4a A T 7: 130,545,893 probably null Het
Nup62 A G 7: 44,829,929 K456R possibly damaging Het
Nwd2 T A 5: 63,806,975 W1301R probably damaging Het
Olfr1141 A G 2: 87,753,318 V225A probably damaging Het
Olfr118 A T 17: 37,672,251 E76V probably damaging Het
Olfr15 T A 16: 3,839,832 N286K probably damaging Het
Olfr364-ps1 T A 2: 37,146,966 S251R probably damaging Het
Oprm1 G T 10: 6,788,960 W29L probably damaging Het
Pcnt T G 10: 76,389,387 N1761T probably benign Het
Pcnt C T 10: 76,401,386 M1355I probably benign Het
Pde11a A T 2: 76,046,855 S757T probably benign Het
Pde6a T A 18: 61,257,045 I490N possibly damaging Het
Pgap1 A G 1: 54,492,090 V742A probably benign Het
Pik3c2b T C 1: 133,090,034 L915P probably damaging Het
Pkd1l1 A G 11: 8,874,179 C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Plxnb2 C T 15: 89,165,921 C491Y probably damaging Het
Ppt1 C A 4: 122,857,609 H300N probably benign Het
Prpf3 T A 3: 95,836,470 Q457L probably benign Het
Ranbp17 C T 11: 33,264,672 V914I probably benign Het
Rasal2 T C 1: 157,175,851 I413V possibly damaging Het
Rb1cc1 G A 1: 6,244,249 V382I possibly damaging Het
Rere T A 4: 150,615,942 F1125I probably damaging Het
Rprd2 A T 3: 95,765,676 V805E possibly damaging Het
Sept10 T G 10: 59,166,606 E162A probably damaging Het
Sept12 G T 16: 4,992,295 D125E probably benign Het
Serpina6 A G 12: 103,654,473 Y6H probably benign Het
Serpinb3c T C 1: 107,272,787 M209V probably damaging Het
Slc2a7 A T 4: 150,168,471 T523S probably damaging Het
Smdt1 T C 15: 82,346,175 V31A possibly damaging Het
Snrnp48 T C 13: 38,220,704 I245T probably damaging Het
Spink2 G A 5: 77,206,965 T33I probably damaging Het
Sptan1 A G 2: 30,027,127 T2204A probably damaging Het
Synj2 A G 17: 6,025,017 D306G probably benign Het
Tas2r109 A G 6: 132,980,910 I19T possibly damaging Het
Tbk1 C T 10: 121,559,935 V418M probably benign Het
Tcerg1 A G 18: 42,553,430 E684G probably damaging Het
Tenm2 T C 11: 36,300,220 N308S probably damaging Het
Tfb2m A T 1: 179,537,861 probably null Het
Tmc1 T A 19: 20,816,122 L558F probably damaging Het
Tmprss5 T A 9: 49,109,134 I80N possibly damaging Het
Trappc2l G A 8: 122,615,407 V131M probably damaging Het
Trpm7 A C 2: 126,822,599 Y953* probably null Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a6b G A 1: 88,107,261 G107D probably benign Het
Vmn1r197 A T 13: 22,328,350 Y147F probably benign Het
Zfp507 A T 7: 35,794,801 N272K possibly damaging Het
Zfp526 G A 7: 25,226,262 E649K probably benign Het
Zswim6 G A 13: 107,727,234 noncoding transcript Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGCAACACCTCAGTAGTTGATAGC -3'
(R):5'- TTCCTCGCAGGAACAGATAACTGCATC -3'

Sequencing Primer
(F):5'- tggaagtcaagcaggtcag -3'
(R):5'- ATCCTGAGCCCAAGGATGG -3'
Posted On2014-04-13