Incidental Mutation 'R1542:Zfp526'
ID 171813
Institutional Source Beutler Lab
Gene Symbol Zfp526
Ensembl Gene ENSMUSG00000046541
Gene Name zinc finger protein 526
Synonyms D030024H03Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 24920850-24926932 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24925687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 649 (E649K)
Ref Sequence ENSEMBL: ENSMUSP00000053567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055604] [ENSMUST00000071739] [ENSMUST00000108411]
AlphaFold Q8BI66
Predicted Effect probably benign
Transcript: ENSMUST00000055604
AA Change: E649K

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053567
Gene: ENSMUSG00000046541
AA Change: E649K

DomainStartEndE-ValueType
ZnF_C2H2 56 78 1.41e0 SMART
low complexity region 79 90 N/A INTRINSIC
ZnF_C2H2 108 130 9.46e0 SMART
ZnF_C2H2 140 163 4.65e-1 SMART
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 200 222 4.72e-2 SMART
coiled coil region 234 254 N/A INTRINSIC
ZnF_C2H2 280 303 1.26e1 SMART
ZnF_C2H2 312 334 3.29e-1 SMART
ZnF_C2H2 339 361 6.78e-3 SMART
ZnF_C2H2 367 389 4.65e-1 SMART
ZnF_C2H2 395 416 3.56e1 SMART
ZnF_C2H2 447 470 8.47e-4 SMART
ZnF_C2H2 477 499 2.05e-2 SMART
ZnF_C2H2 505 527 2.09e-3 SMART
ZnF_C2H2 533 555 5.99e-4 SMART
ZnF_C2H2 578 600 8.22e-2 SMART
low complexity region 610 624 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071739
SMART Domains Protein: ENSMUSP00000071654
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 481 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108411
SMART Domains Protein: ENSMUSP00000104049
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 477 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169914
SMART Domains Protein: ENSMUSP00000126890
Gene: ENSMUSG00000090330

DomainStartEndE-ValueType
low complexity region 77 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206654
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Zfp526
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Zfp526 APN 7 24,924,958 (GRCm39) missense possibly damaging 0.89
IGL02983:Zfp526 APN 7 24,923,840 (GRCm39) missense probably benign 0.27
IGL03123:Zfp526 APN 7 24,924,049 (GRCm39) missense probably benign
R0456:Zfp526 UTSW 7 24,925,637 (GRCm39) missense probably damaging 1.00
R1269:Zfp526 UTSW 7 24,923,788 (GRCm39) missense probably benign
R1668:Zfp526 UTSW 7 24,924,967 (GRCm39) missense probably benign 0.15
R1742:Zfp526 UTSW 7 24,923,939 (GRCm39) missense possibly damaging 0.93
R1870:Zfp526 UTSW 7 24,924,594 (GRCm39) missense possibly damaging 0.67
R3791:Zfp526 UTSW 7 24,925,628 (GRCm39) missense probably damaging 0.98
R4755:Zfp526 UTSW 7 24,925,064 (GRCm39) missense probably benign 0.00
R4833:Zfp526 UTSW 7 24,925,295 (GRCm39) missense probably damaging 1.00
R5549:Zfp526 UTSW 7 24,925,109 (GRCm39) missense possibly damaging 0.82
R5853:Zfp526 UTSW 7 24,924,601 (GRCm39) nonsense probably null
R6061:Zfp526 UTSW 7 24,925,757 (GRCm39) missense probably damaging 1.00
R6186:Zfp526 UTSW 7 24,925,561 (GRCm39) missense probably benign
R7270:Zfp526 UTSW 7 24,925,345 (GRCm39) missense probably damaging 1.00
R7882:Zfp526 UTSW 7 24,920,860 (GRCm39) unclassified probably benign
R8084:Zfp526 UTSW 7 24,924,737 (GRCm39) missense probably damaging 0.99
R9016:Zfp526 UTSW 7 24,925,264 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCGAGCAAGGAGTTTGAC -3'
(R):5'- AGCCTTGGCAAACCCCATTCTG -3'

Sequencing Primer
(F):5'- AGCAAGGAGTTTGACCCTGC -3'
(R):5'- TTGGTAGGGACTCAGACAGATCC -3'
Posted On 2014-04-13