Incidental Mutation 'R1542:Nup62'
ID 171818
Institutional Source Beutler Lab
Gene Symbol Nup62
Ensembl Gene ENSMUSG00000109511
Gene Name nucleoporin 62
Synonyms D7Ertd649e, p62, Nupc1
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 44465512-44480236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44479353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 456 (K456R)
Ref Sequence ENSEMBL: ENSMUSP00000146695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047085] [ENSMUST00000057195] [ENSMUST00000118125] [ENSMUST00000207085] [ENSMUST00000207103] [ENSMUST00000208172] [ENSMUST00000208626]
AlphaFold Q63850
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057195
AA Change: K456R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056785
Gene: ENSMUSG00000109511
AA Change: K456R

DomainStartEndE-ValueType
low complexity region 3 81 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 199 251 N/A INTRINSIC
low complexity region 262 296 N/A INTRINSIC
Pfam:Nsp1_C 317 433 2.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107891
AA Change: K456R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103523
Gene: ENSMUSG00000043858
AA Change: K456R

DomainStartEndE-ValueType
low complexity region 3 81 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 199 251 N/A INTRINSIC
low complexity region 262 296 N/A INTRINSIC
Pfam:Nsp1_C 318 433 8.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149779
Predicted Effect probably benign
Transcript: ENSMUST00000207085
Predicted Effect possibly damaging
Transcript: ENSMUST00000207103
AA Change: K456R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208172
Predicted Effect possibly damaging
Transcript: ENSMUST00000208626
AA Change: K456R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Nup62
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1867:Nup62 UTSW 7 44,478,472 (GRCm39) missense possibly damaging 0.92
R1868:Nup62 UTSW 7 44,478,472 (GRCm39) missense possibly damaging 0.92
R2100:Nup62 UTSW 7 44,478,921 (GRCm39) unclassified probably benign
R4884:Nup62 UTSW 7 44,478,289 (GRCm39) missense probably damaging 0.99
R4977:Nup62 UTSW 7 44,478,449 (GRCm39) missense possibly damaging 0.92
R5808:Nup62 UTSW 7 44,479,416 (GRCm39) missense possibly damaging 0.53
R6052:Nup62 UTSW 7 44,478,464 (GRCm39) missense possibly damaging 0.93
R6895:Nup62 UTSW 7 44,479,157 (GRCm39) missense possibly damaging 0.71
R7757:Nup62 UTSW 7 44,478,419 (GRCm39) missense probably benign 0.00
R8322:Nup62 UTSW 7 44,478,440 (GRCm39) missense possibly damaging 0.92
X0026:Nup62 UTSW 7 44,478,398 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGACTTTATCCTGTCGCAGCAGAAG -3'
(R):5'- TTCACATTGGTCTCCAGAGCACAC -3'

Sequencing Primer
(F):5'- AGGAGCTGGAAGACCTCCTG -3'
(R):5'- GTCTCCAGAGCACACAGGTTATATC -3'
Posted On 2014-04-13