Incidental Mutation 'R1542:Mical2'
ID171822
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms5330438E18Rik
MMRRC Submission 039581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R1542 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location112225856-112355194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112309468 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 211 (L211P)
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
Predicted Effect probably damaging
Transcript: ENSMUST00000037991
AA Change: L211P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: L211P

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050149
AA Change: L211P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: L211P

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106647
SMART Domains Protein: ENSMUSP00000102258
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:NAD_binding_7 83 172 5.9e-7 PFAM
Pfam:FAD_binding_3 86 144 5.9e-9 PFAM
Pfam:Pyr_redox 88 126 3.4e-6 PFAM
Pfam:FAD_binding_2 88 127 4.8e-7 PFAM
Pfam:Pyr_redox_2 88 245 2.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106648
SMART Domains Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 9.5e-9 PFAM
Pfam:FAD_binding_2 88 127 1.3e-6 PFAM
Pfam:Pyr_redox_2 88 263 1e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 1.71e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,406 M208T possibly damaging Het
Acsbg2 T A 17: 56,849,791 I416F probably damaging Het
Adam6b G A 12: 113,490,939 D459N possibly damaging Het
Adprh A T 16: 38,445,924 D285E probably damaging Het
Aggf1 A T 13: 95,370,942 C112S probably benign Het
Als2cl T C 9: 110,894,034 V602A probably benign Het
Angptl2 G T 2: 33,228,885 V224F probably benign Het
Ap3b2 A T 7: 81,478,077 probably null Het
Aqp2 A C 15: 99,583,842 I206L probably benign Het
Asap2 A G 12: 21,265,997 D930G probably damaging Het
Cacna1e T A 1: 154,477,779 M682L probably benign Het
Ccdc18 A G 5: 108,212,188 N1146S probably benign Het
Ccr4 G A 9: 114,492,005 H331Y probably benign Het
Cd33 A G 7: 43,532,106 L210P probably damaging Het
Cep85l T C 10: 53,301,584 E351G probably damaging Het
Cntn6 C A 6: 104,848,100 T867K probably damaging Het
Cpeb2 C T 5: 43,285,875 R970C probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dscaml1 T A 9: 45,749,440 I1693K possibly damaging Het
Ebf4 A T 2: 130,365,498 M621L probably benign Het
Elp4 G T 2: 105,794,609 T313N probably benign Het
Epas1 T A 17: 86,824,490 I373N possibly damaging Het
Etnk1 A T 6: 143,180,641 M71L probably benign Het
Fry C T 5: 150,404,966 T1257I probably benign Het
Gm21834 A G 17: 57,741,951 F90S possibly damaging Het
Gm8674 T A 13: 49,900,003 noncoding transcript Het
Gna11 T C 10: 81,533,328 T134A probably benign Het
Golga5 C T 12: 102,474,720 S238F probably damaging Het
Grin2a T A 16: 9,579,203 N1007Y probably damaging Het
Hist1h3e A G 13: 23,562,164 F68L probably damaging Het
Ifnar2 G A 16: 91,399,265 V253M possibly damaging Het
Insl5 A T 4: 103,018,185 S123T probably damaging Het
Itgb2 T C 10: 77,559,486 S474P probably benign Het
Kcnb2 A G 1: 15,710,788 H628R probably benign Het
L3mbtl2 G A 15: 81,682,151 D392N probably null Het
Lrp1b G T 2: 41,123,712 T1813K probably damaging Het
Map3k4 A G 17: 12,235,906 L1399P probably damaging Het
Mbtps1 A C 8: 119,546,247 probably null Het
Mettl25 A T 10: 105,826,120 S330T probably benign Het
Mmrn1 T A 6: 60,945,118 S186R probably damaging Het
Mob3b C A 4: 35,084,046 V48L possibly damaging Het
Mpp6 A G 6: 50,198,326 Y539C probably damaging Het
Napsa A T 7: 44,581,689 H114L probably damaging Het
Nsmce4a A T 7: 130,545,893 probably null Het
Nup62 A G 7: 44,829,929 K456R possibly damaging Het
Nwd2 T A 5: 63,806,975 W1301R probably damaging Het
Olfr1141 A G 2: 87,753,318 V225A probably damaging Het
Olfr118 A T 17: 37,672,251 E76V probably damaging Het
Olfr15 T A 16: 3,839,832 N286K probably damaging Het
Olfr364-ps1 T A 2: 37,146,966 S251R probably damaging Het
Oprm1 G T 10: 6,788,960 W29L probably damaging Het
Pcnt T G 10: 76,389,387 N1761T probably benign Het
Pcnt C T 10: 76,401,386 M1355I probably benign Het
Pde11a A T 2: 76,046,855 S757T probably benign Het
Pde6a T A 18: 61,257,045 I490N possibly damaging Het
Pgap1 A G 1: 54,492,090 V742A probably benign Het
Pik3c2b T C 1: 133,090,034 L915P probably damaging Het
Pkd1l1 A G 11: 8,874,179 C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Plxnb2 C T 15: 89,165,921 C491Y probably damaging Het
Ppt1 C A 4: 122,857,609 H300N probably benign Het
Prpf3 T A 3: 95,836,470 Q457L probably benign Het
Ranbp17 C T 11: 33,264,672 V914I probably benign Het
Rasal2 T C 1: 157,175,851 I413V possibly damaging Het
Rb1cc1 G A 1: 6,244,249 V382I possibly damaging Het
Rere T A 4: 150,615,942 F1125I probably damaging Het
Rprd2 A T 3: 95,765,676 V805E possibly damaging Het
Sept10 T G 10: 59,166,606 E162A probably damaging Het
Sept12 G T 16: 4,992,295 D125E probably benign Het
Serpina6 A G 12: 103,654,473 Y6H probably benign Het
Serpinb3c T C 1: 107,272,787 M209V probably damaging Het
Slc2a7 A T 4: 150,168,471 T523S probably damaging Het
Smdt1 T C 15: 82,346,175 V31A possibly damaging Het
Snrnp48 T C 13: 38,220,704 I245T probably damaging Het
Spink2 G A 5: 77,206,965 T33I probably damaging Het
Sptan1 A G 2: 30,027,127 T2204A probably damaging Het
Synj2 A G 17: 6,025,017 D306G probably benign Het
Tas2r109 A G 6: 132,980,910 I19T possibly damaging Het
Tbk1 C T 10: 121,559,935 V418M probably benign Het
Tcerg1 A G 18: 42,553,430 E684G probably damaging Het
Tenm2 T C 11: 36,300,220 N308S probably damaging Het
Tfb2m A T 1: 179,537,861 probably null Het
Tmc1 T A 19: 20,816,122 L558F probably damaging Het
Tmprss5 T A 9: 49,109,134 I80N possibly damaging Het
Trappc2l G A 8: 122,615,407 V131M probably damaging Het
Trpm7 A C 2: 126,822,599 Y953* probably null Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a6b G A 1: 88,107,261 G107D probably benign Het
Vmn1r197 A T 13: 22,328,350 Y147F probably benign Het
Zfp507 A T 7: 35,794,801 N272K possibly damaging Het
Zfp526 G A 7: 25,226,262 E649K probably benign Het
Zswim6 G A 13: 107,727,234 noncoding transcript Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R7932:Mical2 UTSW 7 112323461 intron probably null
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGATGAGAAGCCATTGAGTTGG -3'
(R):5'- GGTGCTCTGAAAGGGTTCTGCTAC -3'

Sequencing Primer
(F):5'- ccattaaaaaccctccattgcc -3'
(R):5'- GAAAGGGTTCTGCTACCCATATTC -3'
Posted On2014-04-13