Mutagenetix > Incidental Mutations

Incidental Mutation 'R1542:Mbtps1'

171826

Institutional Source

Beutler Lab

Gene Symbol

Mbtps1

Ensembl Gene

ENSMUSG00000031835

Gene Name

membrane-bound transcription factor peptidase, site 1

Synonyms

subtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik

MMRRC Submission

039581-MU

Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119508156-119558735 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 119546247 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]

Predicted Effect

probably null
Transcript: ENSMUST00000081381

SMART Domains

Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	209	464	1.5e-43	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098362

SMART Domains

Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	213	473	3.7e-45	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212685

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212813

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Mbtps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
muskrat	UTSW	8	119538137	missense	probably damaging	1.00
packrat	UTSW	8	119528961	missense	probably damaging	1.00
woodrat	UTSW	8	119529030	missense	probably damaging	1.00
R0194:Mbtps1	UTSW	8	119535369	missense	probably damaging	1.00
R0270:Mbtps1	UTSW	8	119538117	splice site	probably benign
R0485:Mbtps1	UTSW	8	119522601	splice site	probably benign
R1269:Mbtps1	UTSW	8	119520277	missense	probably damaging	1.00
R1351:Mbtps1	UTSW	8	119518162	missense	possibly damaging	0.95
R1536:Mbtps1	UTSW	8	119546125	missense	probably benign	0.01
R1543:Mbtps1	UTSW	8	119542069	splice site	probably benign
R1580:Mbtps1	UTSW	8	119538900	missense	possibly damaging	0.79
R1587:Mbtps1	UTSW	8	119518219	missense	probably damaging	0.96
R1715:Mbtps1	UTSW	8	119542730	missense	probably benign	0.40
R1845:Mbtps1	UTSW	8	119522493	missense	probably benign	0.13
R2147:Mbtps1	UTSW	8	119538859	missense	probably benign	0.01
R2157:Mbtps1	UTSW	8	119542727	missense	probably benign	0.01
R2416:Mbtps1	UTSW	8	119538917	missense	probably damaging	1.00
R2910:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R2911:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R3079:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3079:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R3080:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3080:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R4116:Mbtps1	UTSW	8	119541652	missense	probably benign	0.00
R4296:Mbtps1	UTSW	8	119522499	missense	possibly damaging	0.95
R4602:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4603:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4610:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4611:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4729:Mbtps1	UTSW	8	119525420	missense	probably damaging	1.00
R4868:Mbtps1	UTSW	8	119508928	missense	probably benign	0.01
R4893:Mbtps1	UTSW	8	119518193	missense	probably damaging	1.00
R4999:Mbtps1	UTSW	8	119533348	missense	probably damaging	1.00
R6056:Mbtps1	UTSW	8	119515602	missense	probably benign
R6062:Mbtps1	UTSW	8	119531091	missense	possibly damaging	0.94
R6237:Mbtps1	UTSW	8	119528961	missense	probably damaging	1.00
R6617:Mbtps1	UTSW	8	119538137	missense	probably damaging	1.00
R7215:Mbtps1	UTSW	8	119524568	missense	possibly damaging	0.82
R7275:Mbtps1	UTSW	8	119542750	missense	probably benign
R7794:Mbtps1	UTSW	8	119538884	missense	probably damaging	1.00
RF019:Mbtps1	UTSW	8	119525550	missense	probably damaging	1.00
X0017:Mbtps1	UTSW	8	119531124	missense	probably damaging	1.00
X0027:Mbtps1	UTSW	8	119522547	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGAACGAAAGACTTTCCGCTG -3'
(R):5'- TGAATCTCTGCATGTTGCCACCTG -3'

Sequencing Primer
(F):5'- ATCTTCAAGTGTGAGCAGCC -3'
(R):5'- ATGTTGCCACCTGTGGTC -3'

Posted On

2014-04-13