Incidental Mutation 'R1542:Dscaml1'
ID 171828
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene Name DS cell adhesion molecule like 1
Synonyms 4921507G06Rik, 4930435C18Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 45338735-45665011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45660738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 1693 (I1693K)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592]
AlphaFold Q4VA61
Predicted Effect possibly damaging
Transcript: ENSMUST00000034592
AA Change: I1693K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: I1693K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215027
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45,581,498 (GRCm39) nonsense probably null
IGL00497:Dscaml1 APN 9 45,663,536 (GRCm39) missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45,662,551 (GRCm39) missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45,594,970 (GRCm39) missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45,613,960 (GRCm39) splice site probably benign
IGL01125:Dscaml1 APN 9 45,660,930 (GRCm39) critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45,663,626 (GRCm39) nonsense probably null
IGL01356:Dscaml1 APN 9 45,658,155 (GRCm39) missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45,653,981 (GRCm39) nonsense probably null
IGL01552:Dscaml1 APN 9 45,359,206 (GRCm39) missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45,595,080 (GRCm39) missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45,658,241 (GRCm39) nonsense probably null
IGL02095:Dscaml1 APN 9 45,359,001 (GRCm39) missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45,594,999 (GRCm39) missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45,643,378 (GRCm39) missense probably benign 0.44
IGL02262:Dscaml1 APN 9 45,656,414 (GRCm39) missense probably benign
IGL02340:Dscaml1 APN 9 45,581,474 (GRCm39) missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45,655,626 (GRCm39) unclassified probably benign
IGL02619:Dscaml1 APN 9 45,359,094 (GRCm39) missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45,359,195 (GRCm39) missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45,581,401 (GRCm39) missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45,595,623 (GRCm39) missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45,654,297 (GRCm39) missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45,653,978 (GRCm39) nonsense probably null
R0582:Dscaml1 UTSW 9 45,579,562 (GRCm39) missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45,632,716 (GRCm39) missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45,643,432 (GRCm39) missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45,656,372 (GRCm39) missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45,663,647 (GRCm39) splice site probably benign
R1449:Dscaml1 UTSW 9 45,653,521 (GRCm39) missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45,596,519 (GRCm39) missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45,583,941 (GRCm39) missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45,361,882 (GRCm39) missense probably damaging 0.99
R1572:Dscaml1 UTSW 9 45,632,631 (GRCm39) missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45,664,445 (GRCm39) missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45,584,047 (GRCm39) missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45,663,988 (GRCm39) missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45,595,054 (GRCm39) missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45,662,584 (GRCm39) critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45,594,930 (GRCm39) missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45,651,778 (GRCm39) missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45,581,522 (GRCm39) missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45,661,430 (GRCm39) missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45,596,532 (GRCm39) missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45,656,376 (GRCm39) missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45,643,435 (GRCm39) missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45,628,782 (GRCm39) missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45,643,366 (GRCm39) missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45,361,878 (GRCm39) missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45,361,890 (GRCm39) missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45,583,993 (GRCm39) missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45,581,404 (GRCm39) missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45,656,487 (GRCm39) missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45,628,730 (GRCm39) missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45,361,857 (GRCm39) missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45,656,483 (GRCm39) missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45,632,596 (GRCm39) missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45,361,881 (GRCm39) missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45,579,458 (GRCm39) missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45,594,975 (GRCm39) nonsense probably null
R6527:Dscaml1 UTSW 9 45,623,482 (GRCm39) nonsense probably null
R6582:Dscaml1 UTSW 9 45,664,104 (GRCm39) missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45,658,235 (GRCm39) missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45,621,609 (GRCm39) missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45,361,881 (GRCm39) missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45,595,128 (GRCm39) missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45,341,805 (GRCm39) missense probably benign
R6967:Dscaml1 UTSW 9 45,585,821 (GRCm39) missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45,581,437 (GRCm39) missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45,654,044 (GRCm39) critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45,656,423 (GRCm39) missense probably benign 0.00
R7338:Dscaml1 UTSW 9 45,585,802 (GRCm39) missense probably benign 0.12
R7343:Dscaml1 UTSW 9 45,664,214 (GRCm39) missense probably benign
R7395:Dscaml1 UTSW 9 45,613,703 (GRCm39) missense possibly damaging 0.73
R7439:Dscaml1 UTSW 9 45,621,624 (GRCm39) missense possibly damaging 0.94
R7484:Dscaml1 UTSW 9 45,660,744 (GRCm39) splice site probably null
R7545:Dscaml1 UTSW 9 45,596,681 (GRCm39) missense probably benign 0.11
R7979:Dscaml1 UTSW 9 45,595,029 (GRCm39) missense probably damaging 1.00
R8005:Dscaml1 UTSW 9 45,628,808 (GRCm39) missense probably damaging 1.00
R8181:Dscaml1 UTSW 9 45,658,140 (GRCm39) missense possibly damaging 0.86
R8262:Dscaml1 UTSW 9 45,658,438 (GRCm39) intron probably benign
R8428:Dscaml1 UTSW 9 45,653,884 (GRCm39) missense probably benign 0.00
R8725:Dscaml1 UTSW 9 45,341,759 (GRCm39) missense probably benign 0.00
R8727:Dscaml1 UTSW 9 45,341,759 (GRCm39) missense probably benign 0.00
R8796:Dscaml1 UTSW 9 45,359,026 (GRCm39) missense probably damaging 0.99
R8840:Dscaml1 UTSW 9 45,634,718 (GRCm39) missense probably damaging 0.99
R9291:Dscaml1 UTSW 9 45,359,251 (GRCm39) missense probably damaging 1.00
R9394:Dscaml1 UTSW 9 45,661,354 (GRCm39) missense possibly damaging 0.64
R9610:Dscaml1 UTSW 9 45,579,522 (GRCm39) missense possibly damaging 0.95
R9611:Dscaml1 UTSW 9 45,579,522 (GRCm39) missense possibly damaging 0.95
R9653:Dscaml1 UTSW 9 45,643,466 (GRCm39) critical splice donor site probably null
R9699:Dscaml1 UTSW 9 45,654,315 (GRCm39) missense probably damaging 0.97
X0058:Dscaml1 UTSW 9 45,663,426 (GRCm39) missense probably benign 0.00
Z1177:Dscaml1 UTSW 9 45,584,089 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCTCTGCTGGATGGAACAAAAC -3'
(R):5'- AGTGAATTCCTGGCCTGCTGAGTG -3'

Sequencing Primer
(F):5'- GCAAACTGGAAACCATTGCTG -3'
(R):5'- CTATAGCTAGATCCTGGGCACAG -3'
Posted On 2014-04-13