Mutagenetix > Incidental Mutation

Incidental Mutation 'R1542:Pkd1l1'

171842

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

039581-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8874179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1129 (C1129R)

Ref Sequence

ENSEMBL: ENSMUSP00000136518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000154153
AA Change: C1579R

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: C1579R

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178195
AA Change: C1129R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: C1129R

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr118	A	T	17: 37,672,251	E76V	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
R9496:Pkd1l1	UTSW	11	8833773	critical splice donor site	probably null
R9504:Pkd1l1	UTSW	11	8865631	missense
R9563:Pkd1l1	UTSW	11	8865502	missense
R9570:Pkd1l1	UTSW	11	8890697	missense
R9585:Pkd1l1	UTSW	11	8854390	missense
R9618:Pkd1l1	UTSW	11	8961420	missense
R9709:Pkd1l1	UTSW	11	8849016	missense	probably damaging	0.98
R9741:Pkd1l1	UTSW	11	8947224	missense
R9801:Pkd1l1	UTSW	11	8958964	nonsense	probably null
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- AAATGTCCCCTCCTGGAGGAGAAG -3'
(R):5'- AATGCTATTTGGAACCCACTGTCCC -3'

Sequencing Primer
(F):5'- tctttgatgtgttgtcagttcc -3'
(R):5'- TGGAACCCACTGTCCCTAATG -3'

Posted On

2014-04-13