Incidental Mutation 'R1542:Tenm2'
ID 171844
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms D3Bwg1534e, Odz2, 9330187F13Rik, Ten-m2, 2610040L17Rik
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 35897483-37126791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36191047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: N308S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: N308S

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102801
AA Change: N308S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: N308S

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155147
Predicted Effect probably benign
Transcript: ENSMUST00000163524
AA Change: N308S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: N308S

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36,097,726 (GRCm39) splice site probably benign
IGL00834:Tenm2 APN 11 35,915,085 (GRCm39) missense probably damaging 1.00
IGL00911:Tenm2 APN 11 35,899,560 (GRCm39) nonsense probably null
IGL00937:Tenm2 APN 11 35,915,450 (GRCm39) missense probably damaging 1.00
IGL01154:Tenm2 APN 11 35,932,371 (GRCm39) missense probably damaging 1.00
IGL01313:Tenm2 APN 11 35,915,075 (GRCm39) missense probably damaging 0.98
IGL01346:Tenm2 APN 11 35,918,232 (GRCm39) nonsense probably null
IGL01539:Tenm2 APN 11 35,997,654 (GRCm39) missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36,755,711 (GRCm39) missense probably damaging 0.98
IGL01780:Tenm2 APN 11 35,937,768 (GRCm39) missense probably benign
IGL01821:Tenm2 APN 11 35,914,710 (GRCm39) missense probably damaging 0.98
IGL01988:Tenm2 APN 11 35,918,078 (GRCm39) missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36,097,922 (GRCm39) missense probably benign
IGL02449:Tenm2 APN 11 35,914,449 (GRCm39) missense probably damaging 0.99
IGL02505:Tenm2 APN 11 35,942,743 (GRCm39) nonsense probably null
IGL02649:Tenm2 APN 11 36,097,912 (GRCm39) missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 35,959,285 (GRCm39) missense probably benign 0.05
IGL02801:Tenm2 APN 11 35,937,857 (GRCm39) nonsense probably null
IGL02928:Tenm2 APN 11 35,917,997 (GRCm39) missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 35,932,471 (GRCm39) missense probably damaging 1.00
IGL03202:Tenm2 APN 11 35,915,375 (GRCm39) missense probably damaging 1.00
IGL03213:Tenm2 APN 11 35,914,157 (GRCm39) missense probably benign 0.05
IGL03276:Tenm2 APN 11 35,963,603 (GRCm39) missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 35,942,852 (GRCm39) splice site probably null
IGL03381:Tenm2 APN 11 35,959,238 (GRCm39) missense probably benign 0.01
IGL03398:Tenm2 APN 11 35,915,370 (GRCm39) missense probably damaging 1.00
browser UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
mosaic UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36,164,235 (GRCm39) missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 35,954,729 (GRCm39) missense probably damaging 0.99
R0004:Tenm2 UTSW 11 35,914,184 (GRCm39) missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36,097,951 (GRCm39) splice site probably benign
R0537:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
R0599:Tenm2 UTSW 11 35,915,607 (GRCm39) missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36,834,803 (GRCm39) missense probably damaging 1.00
R0693:Tenm2 UTSW 11 35,915,636 (GRCm39) missense probably damaging 1.00
R0991:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36,755,511 (GRCm39) missense probably benign 0.30
R1177:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 35,899,185 (GRCm39) missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 35,932,486 (GRCm39) missense probably damaging 1.00
R1272:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 35,959,421 (GRCm39) splice site probably benign
R1374:Tenm2 UTSW 11 35,899,281 (GRCm39) missense probably benign 0.00
R1573:Tenm2 UTSW 11 35,937,896 (GRCm39) missense probably damaging 1.00
R1579:Tenm2 UTSW 11 35,997,610 (GRCm39) missense probably damaging 1.00
R1697:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 35,898,930 (GRCm39) missense probably damaging 1.00
R1756:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 35,914,209 (GRCm39) missense probably damaging 0.99
R1950:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 35,938,374 (GRCm39) missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 35,938,091 (GRCm39) nonsense probably null
R2117:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36,755,689 (GRCm39) missense probably damaging 0.98
R2298:Tenm2 UTSW 11 35,937,604 (GRCm39) missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 35,918,018 (GRCm39) missense probably damaging 1.00
R3014:Tenm2 UTSW 11 35,914,800 (GRCm39) missense probably damaging 1.00
R3115:Tenm2 UTSW 11 35,914,193 (GRCm39) missense probably damaging 1.00
R3684:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3685:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3705:Tenm2 UTSW 11 35,959,153 (GRCm39) missense probably damaging 0.97
R3820:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3821:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3822:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3844:Tenm2 UTSW 11 35,938,365 (GRCm39) missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36,030,401 (GRCm39) critical splice donor site probably null
R4019:Tenm2 UTSW 11 35,937,901 (GRCm39) missense probably benign 0.04
R4062:Tenm2 UTSW 11 35,899,482 (GRCm39) missense probably damaging 1.00
R4367:Tenm2 UTSW 11 35,918,225 (GRCm39) missense probably benign
R4395:Tenm2 UTSW 11 35,915,451 (GRCm39) missense probably benign 0.23
R4508:Tenm2 UTSW 11 35,899,172 (GRCm39) missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 35,953,931 (GRCm39) missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 35,937,607 (GRCm39) missense probably damaging 1.00
R4644:Tenm2 UTSW 11 35,937,963 (GRCm39) missense probably benign 0.00
R4661:Tenm2 UTSW 11 35,915,275 (GRCm39) missense probably damaging 0.99
R4669:Tenm2 UTSW 11 35,901,314 (GRCm39) missense probably damaging 1.00
R4687:Tenm2 UTSW 11 35,939,924 (GRCm39) missense probably benign
R4711:Tenm2 UTSW 11 36,191,039 (GRCm39) missense probably damaging 0.98
R4816:Tenm2 UTSW 11 35,918,117 (GRCm39) missense probably damaging 1.00
R4843:Tenm2 UTSW 11 35,914,847 (GRCm39) missense probably damaging 1.00
R4850:Tenm2 UTSW 11 35,914,315 (GRCm39) nonsense probably null
R4870:Tenm2 UTSW 11 35,969,396 (GRCm39) missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36,097,907 (GRCm39) missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5073:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5074:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5081:Tenm2 UTSW 11 35,915,460 (GRCm39) missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36,834,989 (GRCm39) missense probably damaging 1.00
R5170:Tenm2 UTSW 11 35,915,633 (GRCm39) missense probably damaging 0.98
R5253:Tenm2 UTSW 11 35,938,028 (GRCm39) nonsense probably null
R5343:Tenm2 UTSW 11 35,960,330 (GRCm39) missense probably benign 0.00
R5493:Tenm2 UTSW 11 36,755,503 (GRCm39) missense probably benign 0.01
R5600:Tenm2 UTSW 11 36,054,541 (GRCm39) splice site probably null
R5677:Tenm2 UTSW 11 36,032,510 (GRCm39) missense probably damaging 0.98
R5703:Tenm2 UTSW 11 35,914,626 (GRCm39) missense probably benign 0.34
R5707:Tenm2 UTSW 11 35,938,009 (GRCm39) missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 35,963,556 (GRCm39) critical splice donor site probably null
R6063:Tenm2 UTSW 11 36,054,544 (GRCm39) critical splice donor site probably null
R6086:Tenm2 UTSW 11 35,899,473 (GRCm39) missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 35,899,610 (GRCm39) missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36,030,517 (GRCm39) missense probably damaging 0.99
R6193:Tenm2 UTSW 11 35,937,621 (GRCm39) missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36,755,686 (GRCm39) missense probably benign 0.44
R6477:Tenm2 UTSW 11 35,901,334 (GRCm39) critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
R6668:Tenm2 UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
R6825:Tenm2 UTSW 11 35,937,711 (GRCm39) missense probably benign 0.02
R6885:Tenm2 UTSW 11 35,914,407 (GRCm39) missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36,062,236 (GRCm39) missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36,054,644 (GRCm39) missense probably damaging 0.99
R7153:Tenm2 UTSW 11 35,915,009 (GRCm39) missense probably damaging 0.98
R7173:Tenm2 UTSW 11 35,932,378 (GRCm39) missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36,062,263 (GRCm39) missense probably damaging 1.00
R7205:Tenm2 UTSW 11 35,939,956 (GRCm39) missense probably damaging 0.99
R7250:Tenm2 UTSW 11 35,963,625 (GRCm39) missense probably damaging 1.00
R7290:Tenm2 UTSW 11 35,914,298 (GRCm39) missense probably damaging 1.00
R7366:Tenm2 UTSW 11 35,960,241 (GRCm39) missense probably benign 0.09
R7432:Tenm2 UTSW 11 36,755,768 (GRCm39) missense probably benign
R7504:Tenm2 UTSW 11 36,030,570 (GRCm39) missense probably damaging 1.00
R7513:Tenm2 UTSW 11 35,942,727 (GRCm39) missense probably benign 0.34
R7523:Tenm2 UTSW 11 35,969,408 (GRCm39) splice site probably null
R7527:Tenm2 UTSW 11 36,097,803 (GRCm39) missense probably damaging 1.00
R7648:Tenm2 UTSW 11 35,997,563 (GRCm39) missense probably damaging 1.00
R7653:Tenm2 UTSW 11 35,938,174 (GRCm39) missense probably benign 0.09
R7717:Tenm2 UTSW 11 36,755,762 (GRCm39) missense probably damaging 0.97
R7739:Tenm2 UTSW 11 35,960,388 (GRCm39) missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 35,914,133 (GRCm39) missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 35,901,276 (GRCm39) missense probably damaging 0.99
R7803:Tenm2 UTSW 11 35,937,943 (GRCm39) missense probably damaging 0.98
R7834:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R7838:Tenm2 UTSW 11 35,997,626 (GRCm39) missense probably benign 0.02
R8073:Tenm2 UTSW 11 36,030,471 (GRCm39) missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 35,918,048 (GRCm39) missense probably benign 0.23
R8109:Tenm2 UTSW 11 35,899,137 (GRCm39) missense probably benign
R8306:Tenm2 UTSW 11 35,960,196 (GRCm39) missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8452:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8864:Tenm2 UTSW 11 35,918,022 (GRCm39) missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 35,942,788 (GRCm39) missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36,834,861 (GRCm39) missense probably damaging 0.98
R8969:Tenm2 UTSW 11 35,942,688 (GRCm39) missense probably damaging 0.99
R9168:Tenm2 UTSW 11 35,930,722 (GRCm39) missense probably damaging 1.00
R9279:Tenm2 UTSW 11 35,959,303 (GRCm39) missense probably benign 0.00
R9294:Tenm2 UTSW 11 35,915,327 (GRCm39) missense probably damaging 0.98
R9320:Tenm2 UTSW 11 35,914,474 (GRCm39) missense probably damaging 0.99
R9373:Tenm2 UTSW 11 35,930,713 (GRCm39) missense probably damaging 1.00
R9408:Tenm2 UTSW 11 35,960,246 (GRCm39) missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36,032,396 (GRCm39) missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36,112,286 (GRCm39) missense probably benign
R9489:Tenm2 UTSW 11 36,834,791 (GRCm39) missense probably damaging 0.99
R9711:Tenm2 UTSW 11 35,915,341 (GRCm39) missense probably damaging 0.99
RF021:Tenm2 UTSW 11 35,915,030 (GRCm39) missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 35,915,027 (GRCm39) missense probably damaging 1.00
X0063:Tenm2 UTSW 11 35,915,557 (GRCm39) missense probably benign
Z1088:Tenm2 UTSW 11 36,164,094 (GRCm39) missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36,191,162 (GRCm39) missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 35,899,061 (GRCm39) missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36,275,957 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCACATTTCCCATGAGCCTTTGAG -3'
(R):5'- GCCTACATCATAGTTGCCGAGTTCC -3'

Sequencing Primer
(F):5'- TTGGGTACACAAGAGCTGTC -3'
(R):5'- CCGAGTTCCTGAGGCTAGAATG -3'
Posted On 2014-04-13