Incidental Mutation 'R1542:L3mbtl2'
ID 171861
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene Name L3MBTL2 polycomb repressive complex 1 subunit
Synonyms 4732493N06Rik, m4mbt
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1542 (G1)
Quality Score 145
Status Not validated
Chromosome 15
Chromosomal Location 81548090-81572516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81566352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 392 (D392N)
Ref Sequence ENSEMBL: ENSMUSP00000133967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000072910] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
AlphaFold P59178
Predicted Effect probably null
Transcript: ENSMUST00000023029
AA Change: D392N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: D392N

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072910
SMART Domains Protein: ENSMUSP00000072682
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
LRRNT 31 65 3.72e-4 SMART
LRR 59 83 1e1 SMART
LRR_TYP 84 107 7.78e-3 SMART
LRR_TYP 108 131 5.81e-2 SMART
LRR_TYP 132 155 3.89e-3 SMART
LRR_TYP 156 179 6.42e-4 SMART
LRR 180 203 1.37e1 SMART
LRR_TYP 204 227 5.5e-3 SMART
LRR 252 275 3.24e0 SMART
LRR 276 299 2.92e1 SMART
LRRCT 309 357 3.81e-2 SMART
low complexity region 358 372 N/A INTRINSIC
LRRNT 394 428 1.51e-4 SMART
LRR 427 446 1.26e2 SMART
LRR 447 470 3.97e0 SMART
LRR 471 494 1.08e-1 SMART
LRR 496 518 6.23e1 SMART
LRR 519 542 9.48e0 SMART
LRR 544 566 6.96e0 SMART
LRR 568 590 1.14e0 SMART
LRR_TYP 591 614 7.09e-6 SMART
LRR 617 639 3.76e1 SMART
LRR 640 665 6.59e1 SMART
LRRCT 674 722 2.87e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172568
AA Change: G392S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect probably null
Transcript: ENSMUST00000172748
AA Change: D392N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: D392N

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173761
Predicted Effect probably benign
Transcript: ENSMUST00000173898
SMART Domains Protein: ENSMUSP00000133981
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 21 40 1.26e2 SMART
LRR 41 64 3.97e0 SMART
LRR 65 88 1.08e-1 SMART
LRR 90 112 6.23e1 SMART
LRR 113 136 9.48e0 SMART
LRR 138 160 6.96e0 SMART
LRR 162 184 1.14e0 SMART
LRR_TYP 185 208 7.09e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174229
AA Change: D392N

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: D392N

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174401
Predicted Effect probably benign
Transcript: ENSMUST00000174497
SMART Domains Protein: ENSMUSP00000133549
Gene: ENSMUSG00000022394

DomainStartEndE-ValueType
Pfam:MBT 12 85 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Serpinb3c T C 1: 107,200,517 (GRCm39) M209V probably damaging Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81,569,099 (GRCm39) missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81,555,326 (GRCm39) missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81,560,593 (GRCm39) missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81,570,456 (GRCm39) missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81,566,194 (GRCm39) missense probably damaging 1.00
PIT4431001:L3mbtl2 UTSW 15 81,560,508 (GRCm39) missense probably benign 0.32
R0393:L3mbtl2 UTSW 15 81,552,942 (GRCm39) missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81,552,942 (GRCm39) missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81,552,942 (GRCm39) missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81,568,487 (GRCm39) splice site probably benign
R1263:L3mbtl2 UTSW 15 81,567,169 (GRCm39) missense probably benign 0.00
R1426:L3mbtl2 UTSW 15 81,560,518 (GRCm39) missense possibly damaging 0.95
R1556:L3mbtl2 UTSW 15 81,566,203 (GRCm39) missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81,559,822 (GRCm39) missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81,566,215 (GRCm39) missense possibly damaging 0.94
R2237:L3mbtl2 UTSW 15 81,568,531 (GRCm39) missense probably benign
R4112:L3mbtl2 UTSW 15 81,566,170 (GRCm39) missense possibly damaging 0.90
R4577:L3mbtl2 UTSW 15 81,570,486 (GRCm39) missense probably benign
R4583:L3mbtl2 UTSW 15 81,569,107 (GRCm39) missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81,566,813 (GRCm39) missense probably benign
R4787:L3mbtl2 UTSW 15 81,548,175 (GRCm39) utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81,568,534 (GRCm39) missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81,569,072 (GRCm39) missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81,571,143 (GRCm39) missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81,551,555 (GRCm39) missense probably benign
R6259:L3mbtl2 UTSW 15 81,566,128 (GRCm39) missense probably damaging 1.00
R7178:L3mbtl2 UTSW 15 81,555,275 (GRCm39) missense probably benign 0.00
R7311:L3mbtl2 UTSW 15 81,551,588 (GRCm39) missense possibly damaging 0.76
R8797:L3mbtl2 UTSW 15 81,569,615 (GRCm39) missense possibly damaging 0.61
R8857:L3mbtl2 UTSW 15 81,571,320 (GRCm39) missense unknown
R9035:L3mbtl2 UTSW 15 81,560,744 (GRCm39) intron probably benign
R9718:L3mbtl2 UTSW 15 81,572,123 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAAGACTCAGGTGTCACGTACCC -3'
(R):5'- ACCAGGCAGGCTACCTTTGTTCTC -3'

Sequencing Primer
(F):5'- TGTCACGTACCCGCATGG -3'
(R):5'- gttacatcttggttttgctgttc -3'
Posted On 2014-04-13