Mutagenetix > Incidental Mutations

Incidental Mutation 'R1542:Olfr118'

171872

Institutional Source

Beutler Lab

Gene Symbol

Olfr118

Ensembl Gene

ENSMUSG00000080990

Gene Name

olfactory receptor 118

Synonyms

MOR263-13, GA_x6K02T2PSCP-2131124-2132089

MMRRC Submission

039581-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R1542 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37666988-37673476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37672251 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 76 (E76V)

Ref Sequence

ENSEMBL: ENSMUSP00000151212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]

Predicted Effect

probably damaging
Transcript: ENSMUST00000122036
AA Change: E76V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: E76V

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srv	32	173	2e-6	PFAM
Pfam:7tm_4	37	314	2.1e-57	PFAM
Pfam:7TM_GPCR_Srsx	41	311	5.8e-6	PFAM
Pfam:7tm_1	47	296	1.4e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215811
AA Change: E76V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216551
AA Change: E76V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,406	M208T	possibly damaging	Het
Acsbg2	T	A	17: 56,849,791	I416F	probably damaging	Het
Adam6b	G	A	12: 113,490,939	D459N	possibly damaging	Het
Adprh	A	T	16: 38,445,924	D285E	probably damaging	Het
Aggf1	A	T	13: 95,370,942	C112S	probably benign	Het
Als2cl	T	C	9: 110,894,034	V602A	probably benign	Het
Angptl2	G	T	2: 33,228,885	V224F	probably benign	Het
Ap3b2	A	T	7: 81,478,077		probably null	Het
Aqp2	A	C	15: 99,583,842	I206L	probably benign	Het
Asap2	A	G	12: 21,265,997	D930G	probably damaging	Het
Cacna1e	T	A	1: 154,477,779	M682L	probably benign	Het
Ccdc18	A	G	5: 108,212,188	N1146S	probably benign	Het
Ccr4	G	A	9: 114,492,005	H331Y	probably benign	Het
Cd33	A	G	7: 43,532,106	L210P	probably damaging	Het
Cep85l	T	C	10: 53,301,584	E351G	probably damaging	Het
Cntn6	C	A	6: 104,848,100	T867K	probably damaging	Het
Cpeb2	C	T	5: 43,285,875	R970C	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dscaml1	T	A	9: 45,749,440	I1693K	possibly damaging	Het
Ebf4	A	T	2: 130,365,498	M621L	probably benign	Het
Elp4	G	T	2: 105,794,609	T313N	probably benign	Het
Epas1	T	A	17: 86,824,490	I373N	possibly damaging	Het
Etnk1	A	T	6: 143,180,641	M71L	probably benign	Het
Fry	C	T	5: 150,404,966	T1257I	probably benign	Het
Gm21834	A	G	17: 57,741,951	F90S	possibly damaging	Het
Gm8674	T	A	13: 49,900,003		noncoding transcript	Het
Gna11	T	C	10: 81,533,328	T134A	probably benign	Het
Golga5	C	T	12: 102,474,720	S238F	probably damaging	Het
Grin2a	T	A	16: 9,579,203	N1007Y	probably damaging	Het
Hist1h3e	A	G	13: 23,562,164	F68L	probably damaging	Het
Ifnar2	G	A	16: 91,399,265	V253M	possibly damaging	Het
Insl5	A	T	4: 103,018,185	S123T	probably damaging	Het
Itgb2	T	C	10: 77,559,486	S474P	probably benign	Het
Kcnb2	A	G	1: 15,710,788	H628R	probably benign	Het
L3mbtl2	G	A	15: 81,682,151	D392N	probably null	Het
Lrp1b	G	T	2: 41,123,712	T1813K	probably damaging	Het
Map3k4	A	G	17: 12,235,906	L1399P	probably damaging	Het
Mbtps1	A	C	8: 119,546,247		probably null	Het
Mettl25	A	T	10: 105,826,120	S330T	probably benign	Het
Mical2	T	C	7: 112,309,468	L211P	probably damaging	Het
Mmrn1	T	A	6: 60,945,118	S186R	probably damaging	Het
Mob3b	C	A	4: 35,084,046	V48L	possibly damaging	Het
Mpp6	A	G	6: 50,198,326	Y539C	probably damaging	Het
Napsa	A	T	7: 44,581,689	H114L	probably damaging	Het
Nsmce4a	A	T	7: 130,545,893		probably null	Het
Nup62	A	G	7: 44,829,929	K456R	possibly damaging	Het
Nwd2	T	A	5: 63,806,975	W1301R	probably damaging	Het
Olfr1141	A	G	2: 87,753,318	V225A	probably damaging	Het
Olfr15	T	A	16: 3,839,832	N286K	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,966	S251R	probably damaging	Het
Oprm1	G	T	10: 6,788,960	W29L	probably damaging	Het
Pcnt	T	G	10: 76,389,387	N1761T	probably benign	Het
Pcnt	C	T	10: 76,401,386	M1355I	probably benign	Het
Pde11a	A	T	2: 76,046,855	S757T	probably benign	Het
Pde6a	T	A	18: 61,257,045	I490N	possibly damaging	Het
Pgap1	A	G	1: 54,492,090	V742A	probably benign	Het
Pik3c2b	T	C	1: 133,090,034	L915P	probably damaging	Het
Pkd1l1	A	G	11: 8,874,179	C1129R	possibly damaging	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Plxnb2	C	T	15: 89,165,921	C491Y	probably damaging	Het
Ppt1	C	A	4: 122,857,609	H300N	probably benign	Het
Prpf3	T	A	3: 95,836,470	Q457L	probably benign	Het
Ranbp17	C	T	11: 33,264,672	V914I	probably benign	Het
Rasal2	T	C	1: 157,175,851	I413V	possibly damaging	Het
Rb1cc1	G	A	1: 6,244,249	V382I	possibly damaging	Het
Rere	T	A	4: 150,615,942	F1125I	probably damaging	Het
Rprd2	A	T	3: 95,765,676	V805E	possibly damaging	Het
Sept10	T	G	10: 59,166,606	E162A	probably damaging	Het
Sept12	G	T	16: 4,992,295	D125E	probably benign	Het
Serpina6	A	G	12: 103,654,473	Y6H	probably benign	Het
Serpinb3c	T	C	1: 107,272,787	M209V	probably damaging	Het
Slc2a7	A	T	4: 150,168,471	T523S	probably damaging	Het
Smdt1	T	C	15: 82,346,175	V31A	possibly damaging	Het
Snrnp48	T	C	13: 38,220,704	I245T	probably damaging	Het
Spink2	G	A	5: 77,206,965	T33I	probably damaging	Het
Sptan1	A	G	2: 30,027,127	T2204A	probably damaging	Het
Synj2	A	G	17: 6,025,017	D306G	probably benign	Het
Tas2r109	A	G	6: 132,980,910	I19T	possibly damaging	Het
Tbk1	C	T	10: 121,559,935	V418M	probably benign	Het
Tcerg1	A	G	18: 42,553,430	E684G	probably damaging	Het
Tenm2	T	C	11: 36,300,220	N308S	probably damaging	Het
Tfb2m	A	T	1: 179,537,861		probably null	Het
Tmc1	T	A	19: 20,816,122	L558F	probably damaging	Het
Tmprss5	T	A	9: 49,109,134	I80N	possibly damaging	Het
Trappc2l	G	A	8: 122,615,407	V131M	probably damaging	Het
Trpm7	A	C	2: 126,822,599	Y953*	probably null	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,261	G107D	probably benign	Het
Vmn1r197	A	T	13: 22,328,350	Y147F	probably benign	Het
Zfp507	A	T	7: 35,794,801	N272K	possibly damaging	Het
Zfp526	G	A	7: 25,226,262	E649K	probably benign	Het
Zswim6	G	A	13: 107,727,234		noncoding transcript	Het

Other mutations in Olfr118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01300:Olfr118	APN	17	37672887	missense	probably damaging	1.00
IGL02456:Olfr118	APN	17	37672449	missense	possibly damaging	0.90
IGL02750:Olfr118	APN	17	37672609	nonsense	probably null
IGL03083:Olfr118	APN	17	37672660	nonsense	probably null
IGL03339:Olfr118	APN	17	37672557	missense	possibly damaging	0.87
R0032:Olfr118	UTSW	17	37672487	missense	probably damaging	1.00
R1457:Olfr118	UTSW	17	37672925	nonsense	probably null
R1771:Olfr118	UTSW	17	37672663	missense	probably damaging	1.00
R1893:Olfr118	UTSW	17	37672856	nonsense	probably null
R2395:Olfr118	UTSW	17	37672696	nonsense	probably null
R3619:Olfr118	UTSW	17	37672640	missense	probably benign	0.05
R3917:Olfr118	UTSW	17	37672793	missense	probably damaging	1.00
R3937:Olfr118	UTSW	17	37672967	missense	probably benign	0.01
R5600:Olfr118	UTSW	17	37672285	missense	possibly damaging	0.91
R6415:Olfr118	UTSW	17	37672557	missense	possibly damaging	0.87
R6462:Olfr118	UTSW	17	37672220	missense	probably damaging	1.00
R7355:Olfr118	UTSW	17	37672410	missense	probably benign	0.02
R7861:Olfr118	UTSW	17	37672517	missense	possibly damaging	0.91
R7913:Olfr118	UTSW	17	37672108	missense	probably benign
R7952:Olfr118	UTSW	17	37672817	missense	probably damaging	1.00
R7969:Olfr118	UTSW	17	37672656	missense	probably damaging	1.00
RF003:Olfr118	UTSW	17	37672858	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCTGAAGAATGCTTCCTCCTG -3'
(R):5'- TGTATCGCCACAAGCAAGTGCC -3'

Sequencing Primer
(F):5'- GAAGAATGCTTCCTCCTGTTTAC -3'
(R):5'- GAAGAAGTGGTCTATCTCACATGGTC -3'

Posted On

2014-04-13