Incidental Mutation 'R1543:Cyp20a1'
ID171884
Institutional Source Beutler Lab
Gene Symbol Cyp20a1
Ensembl Gene ENSMUSG00000049439
Gene Namecytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60343323-60388060 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 60376194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060608] [ENSMUST00000148443]
Predicted Effect probably benign
Transcript: ENSMUST00000060608
SMART Domains Protein: ENSMUSP00000050823
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 40 456 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114202
SMART Domains Protein: ENSMUSP00000109840
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 40 280 1.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148443
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Cyp20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Cyp20a1 APN 1 60371251 missense possibly damaging 0.79
IGL02725:Cyp20a1 APN 1 60366706 missense probably benign 0.08
IGL03394:Cyp20a1 APN 1 60366681 missense probably damaging 0.99
R0003:Cyp20a1 UTSW 1 60387126 splice site probably benign
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0217:Cyp20a1 UTSW 1 60343466 splice site probably benign
R0491:Cyp20a1 UTSW 1 60371327 missense possibly damaging 0.71
R4519:Cyp20a1 UTSW 1 60387147 missense probably damaging 1.00
R4621:Cyp20a1 UTSW 1 60376099 missense probably benign
R4930:Cyp20a1 UTSW 1 60366719 missense probably damaging 0.98
R4980:Cyp20a1 UTSW 1 60363214 missense probably damaging 1.00
R5088:Cyp20a1 UTSW 1 60363350 missense probably damaging 0.99
R5356:Cyp20a1 UTSW 1 60379387 missense probably benign 0.08
R5545:Cyp20a1 UTSW 1 60376082 missense possibly damaging 0.71
R5897:Cyp20a1 UTSW 1 60353061 missense probably damaging 1.00
R5926:Cyp20a1 UTSW 1 60363242 missense possibly damaging 0.52
R6317:Cyp20a1 UTSW 1 60352124 missense probably damaging 1.00
R6320:Cyp20a1 UTSW 1 60352172 critical splice donor site probably null
R7471:Cyp20a1 UTSW 1 60354640 missense probably damaging 0.99
R7681:Cyp20a1 UTSW 1 60353033 missense probably benign 0.01
R7715:Cyp20a1 UTSW 1 60372605 missense probably benign 0.00
R8033:Cyp20a1 UTSW 1 60372591 missense probably benign 0.02
R8259:Cyp20a1 UTSW 1 60352171 critical splice donor site probably null
R8430:Cyp20a1 UTSW 1 60363329 missense possibly damaging 0.90
R8676:Cyp20a1 UTSW 1 60379420 missense possibly damaging 0.95
R8748:Cyp20a1 UTSW 1 60353022 missense probably damaging 0.98
Z1177:Cyp20a1 UTSW 1 60353010 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATGGCGTGGCAAGGCAGG -3'
(R):5'- GCAGCAACTGTCCAGAACAGTTAAGA -3'

Sequencing Primer
(F):5'- GCAGGGGGGCAGATTTAC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-04-13