Incidental Mutation 'R1543:Ppip5k2'
ID171887
Institutional Source Beutler Lab
Gene Symbol Ppip5k2
Ensembl Gene ENSMUSG00000040648
Gene Namediphosphoinositol pentakisphosphate kinase 2
SynonymsHisppd1, Vip2
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97706048-97770411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97740882 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 560 (L560P)
Ref Sequence ENSEMBL: ENSMUSP00000132889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]
Predicted Effect probably damaging
Transcript: ENSMUST00000042509
AA Change: L566P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: L566P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112845
AA Change: L560P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: L560P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 6.9e-141 PFAM
low complexity region 993 1006 N/A INTRINSIC
low complexity region 1192 1211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152788
Predicted Effect probably damaging
Transcript: ENSMUST00000171129
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: L560P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Meta Mutation Damage Score 0.9169 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Ppip5k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Ppip5k2 APN 1 97713123 missense probably damaging 1.00
IGL02266:Ppip5k2 APN 1 97733972 missense possibly damaging 0.68
IGL02705:Ppip5k2 APN 1 97759199 missense probably damaging 1.00
IGL03229:Ppip5k2 APN 1 97728961 missense probably damaging 1.00
P0033:Ppip5k2 UTSW 1 97717528 missense probably damaging 0.98
R0082:Ppip5k2 UTSW 1 97759332 nonsense probably null
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0267:Ppip5k2 UTSW 1 97728997 missense probably damaging 1.00
R0281:Ppip5k2 UTSW 1 97716553 missense possibly damaging 0.95
R0373:Ppip5k2 UTSW 1 97740537 nonsense probably null
R0402:Ppip5k2 UTSW 1 97719854 missense probably benign 0.00
R0423:Ppip5k2 UTSW 1 97761427 missense possibly damaging 0.95
R0613:Ppip5k2 UTSW 1 97752740 nonsense probably null
R0751:Ppip5k2 UTSW 1 97749652 nonsense probably null
R1121:Ppip5k2 UTSW 1 97756860 missense probably damaging 1.00
R1265:Ppip5k2 UTSW 1 97719900 missense probably benign 0.00
R1436:Ppip5k2 UTSW 1 97711782 missense probably benign 0.04
R1739:Ppip5k2 UTSW 1 97728957 missense probably damaging 1.00
R1845:Ppip5k2 UTSW 1 97723806 missense possibly damaging 0.74
R2191:Ppip5k2 UTSW 1 97744110 missense probably damaging 0.99
R2430:Ppip5k2 UTSW 1 97735030 missense probably damaging 1.00
R2762:Ppip5k2 UTSW 1 97717509 missense probably damaging 1.00
R3014:Ppip5k2 UTSW 1 97744075 missense probably damaging 0.99
R3759:Ppip5k2 UTSW 1 97755885 critical splice donor site probably null
R4603:Ppip5k2 UTSW 1 97755136 missense probably damaging 1.00
R4772:Ppip5k2 UTSW 1 97721067 unclassified probably benign
R4951:Ppip5k2 UTSW 1 97711749 missense possibly damaging 0.77
R5348:Ppip5k2 UTSW 1 97747592 missense possibly damaging 0.94
R5350:Ppip5k2 UTSW 1 97721128 missense probably damaging 0.98
R5584:Ppip5k2 UTSW 1 97750641 missense probably damaging 1.00
R5599:Ppip5k2 UTSW 1 97740598 missense probably damaging 1.00
R5883:Ppip5k2 UTSW 1 97707810 missense possibly damaging 0.53
R5898:Ppip5k2 UTSW 1 97744162 intron probably benign
R6184:Ppip5k2 UTSW 1 97734005 missense possibly damaging 0.89
R6221:Ppip5k2 UTSW 1 97730028 missense probably damaging 1.00
R6775:Ppip5k2 UTSW 1 97719860 missense possibly damaging 0.49
R7250:Ppip5k2 UTSW 1 97745462 missense probably benign 0.00
R7329:Ppip5k2 UTSW 1 97750753 splice site probably null
R7357:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R7852:Ppip5k2 UTSW 1 97741171 missense probably damaging 0.99
R7884:Ppip5k2 UTSW 1 97740482 missense probably benign 0.00
R8006:Ppip5k2 UTSW 1 97734106 missense probably benign 0.00
R8134:Ppip5k2 UTSW 1 97745163 missense probably benign 0.12
R8274:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R8436:Ppip5k2 UTSW 1 97755888 missense probably benign
R8440:Ppip5k2 UTSW 1 97747551 missense probably damaging 0.99
R8730:Ppip5k2 UTSW 1 97761431 small deletion probably benign
Z1177:Ppip5k2 UTSW 1 97716605 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGCTGCTGACAGCTACTCAAAG -3'
(R):5'- TACCCTGGAGGTCAAGGTAAGTGC -3'

Sequencing Primer
(F):5'- AAAGGCCGTTCATGTTTGCAC -3'
(R):5'- AGTGCTATGTATCACTTGACCG -3'
Posted On2014-04-13