Incidental Mutation 'R1543:Olfr1294'
ID171895
Institutional Source Beutler Lab
Gene Symbol Olfr1294
Ensembl Gene ENSMUSG00000109547
Gene Nameolfactory receptor 1294
SynonymsGA_x6K02T2Q125-72589785-72588847, MOR248-7
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111536530-111540291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111537797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208334] [ENSMUST00000208675] [ENSMUST00000215245]
Predicted Effect probably benign
Transcript: ENSMUST00000099614
AA Change: V164A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097209
Gene: ENSMUSG00000094000
AA Change: V164A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.7e-51 PFAM
Pfam:7tm_1 41 287 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208334
AA Change: V164A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000208675
AA Change: V164A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Meta Mutation Damage Score 0.2370 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Olfr1294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Olfr1294 APN 2 111538014 missense probably damaging 1.00
IGL02304:Olfr1294 APN 2 111537401 missense probably benign 0.06
IGL02555:Olfr1294 APN 2 111537917 missense probably damaging 0.98
R0422:Olfr1294 UTSW 2 111537983 missense probably damaging 0.97
R0647:Olfr1294 UTSW 2 111537359 missense probably benign 0.00
R0656:Olfr1294 UTSW 2 111537627 missense probably damaging 1.00
R1909:Olfr1294 UTSW 2 111538014 missense probably damaging 1.00
R3735:Olfr1294 UTSW 2 111537896 missense probably damaging 1.00
R4671:Olfr1294 UTSW 2 111537935 missense probably damaging 1.00
R4703:Olfr1294 UTSW 2 111537768 missense probably benign 0.03
R4809:Olfr1294 UTSW 2 111537611 missense probably benign 0.15
R4822:Olfr1294 UTSW 2 111537452 missense probably damaging 0.98
R4837:Olfr1294 UTSW 2 111537974 missense probably damaging 0.98
R4880:Olfr1294 UTSW 2 111537353 nonsense probably null
R5203:Olfr1294 UTSW 2 111537636 missense probably damaging 1.00
R5871:Olfr1294 UTSW 2 111537639 missense probably damaging 1.00
R5902:Olfr1294 UTSW 2 111537394 missense probably benign 0.00
R6501:Olfr1294 UTSW 2 111537779 missense probably damaging 1.00
R7354:Olfr1294 UTSW 2 111537564 missense possibly damaging 0.94
R7575:Olfr1294 UTSW 2 111538252 missense probably damaging 1.00
R7623:Olfr1294 UTSW 2 111537936 missense probably damaging 1.00
R7632:Olfr1294 UTSW 2 111538176 missense possibly damaging 0.87
R7845:Olfr1294 UTSW 2 111538167 nonsense probably null
R8130:Olfr1294 UTSW 2 111537480 missense probably damaging 1.00
Z1088:Olfr1294 UTSW 2 111537814 missense possibly damaging 0.89
Z1176:Olfr1294 UTSW 2 111538285 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCATTGCCTTAGATGCACCAGC -3'
(R):5'- TGACATGTGGCTCTCCACAAACAC -3'

Sequencing Primer
(F):5'- GCCTTAGATGCACCAGCTTTAG -3'
(R):5'- GATGATCACAGATTTTCTCAGGG -3'
Posted On2014-04-13