Incidental Mutation 'R1543:Steap4'
List |< first << previous [record 61 of 78] next >> last >|
ID171908
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 7975902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably benign
Transcript: ENSMUST00000115421
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
R8861:Steap4 UTSW 5 7975672 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGAGCACTATGATTCCCTCACGG -3'
(R):5'- GCGTTTCCAACAGCGAAAGACC -3'

Sequencing Primer
(F):5'- AATACCTTGCTCAGCTGGAG -3'
(R):5'- TTCCAGTCTGGCAAGAGAATTCC -3'
Posted On2014-04-13