Incidental Mutation 'R1543:Cacna2d1'
List |< first << previous [record 18 of 78] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16266718 bp
Amino Acid Change Methionine to Leucine at position 254 (M254L)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039370
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078272
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101581
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115281
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167946
AA Change: M254L

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180204
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199704
AA Change: M254L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: M254L

signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200270
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 splice site probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 splice site probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
R7608:Cacna2d1 UTSW 5 16359024 missense probably damaging 1.00
R7712:Cacna2d1 UTSW 5 16362349 missense probably damaging 0.98
R8014:Cacna2d1 UTSW 5 16342691 missense possibly damaging 0.55
R8161:Cacna2d1 UTSW 5 16314937 missense probably damaging 1.00
R8669:Cacna2d1 UTSW 5 15935015 start codon destroyed probably null 0.53
R8670:Cacna2d1 UTSW 5 15935015 start codon destroyed probably null 0.53
R8682:Cacna2d1 UTSW 5 16353839 missense possibly damaging 0.95
R8697:Cacna2d1 UTSW 5 16365867 missense possibly damaging 0.89
R8807:Cacna2d1 UTSW 5 16267454 missense probably damaging 1.00
R8834:Cacna2d1 UTSW 5 16266737 missense possibly damaging 0.79
RF024:Cacna2d1 UTSW 5 16025776 missense possibly damaging 0.80
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(R):5'- gcactttactgattgagccaAGTCAACA -3'

Sequencing Primer
(F):5'- caggacagccaggacaatac -3'
Posted On2014-04-13