Incidental Mutation 'R1543:Ttc23'
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Nametetratricopeptide repeat domain 23
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosomal Location67647410-67762912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67678995 bp
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000032774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000107470] [ENSMUST00000107471]
Predicted Effect probably benign
Transcript: ENSMUST00000032774
AA Change: V228A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555
AA Change: V228A

Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107470
AA Change: V228A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555
AA Change: V228A

Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107471
AA Change: V228A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555
AA Change: V228A

Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207774
Predicted Effect unknown
Transcript: ENSMUST00000208764
AA Change: V76A
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67667155 unclassified probably benign
IGL03257:Ttc23 APN 7 67711378 missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67662337 utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67678897 missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67709315 splice site probably benign
PIT4445001:Ttc23 UTSW 7 67667213 missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67662387 missense probably damaging 1.00
R0295:Ttc23 UTSW 7 67669852 unclassified probably benign
R0316:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R0336:Ttc23 UTSW 7 67662483 missense probably benign 0.01
R1456:Ttc23 UTSW 7 67667154 unclassified probably benign
R1662:Ttc23 UTSW 7 67725321 splice site probably null
R1708:Ttc23 UTSW 7 67667176 missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R2292:Ttc23 UTSW 7 67669787 missense probably benign 0.08
R4471:Ttc23 UTSW 7 67670156 missense probably benign 0.37
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67669728 missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67670170 missense possibly damaging 0.76
R8305:Ttc23 UTSW 7 67662387 missense probably damaging 0.99
RF009:Ttc23 UTSW 7 67726029 missense possibly damaging 0.61
X0021:Ttc23 UTSW 7 67670131 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctataggtacagttaacattgtcagc -3'
Posted On2014-04-13