Incidental Mutation 'R1543:Deaf1'
List |< first << previous [record 24 of 78] next >> last >|
ID171925
Institutional Source Beutler Lab
Gene Symbol Deaf1
Ensembl Gene ENSMUSG00000058886
Gene NameDEAF1, transcription factor
SynonymsC230009B13Rik, suppressin, NUDR
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141297180-141327690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141324147 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000147728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026578] [ENSMUST00000080553] [ENSMUST00000126510] [ENSMUST00000133012] [ENSMUST00000145184] [ENSMUST00000209397] [ENSMUST00000209608] [ENSMUST00000210816] [ENSMUST00000210830] [ENSMUST00000211537]
Predicted Effect probably benign
Transcript: ENSMUST00000026578
SMART Domains Protein: ENSMUSP00000026578
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 108 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080553
AA Change: S109P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886
AA Change: S109P

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126510
SMART Domains Protein: ENSMUSP00000123330
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128649
Predicted Effect probably benign
Transcript: ENSMUST00000133012
SMART Domains Protein: ENSMUSP00000116695
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145184
SMART Domains Protein: ENSMUSP00000117633
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:Transmemb_17 25 78 5.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155657
Predicted Effect probably benign
Transcript: ENSMUST00000209397
Predicted Effect probably benign
Transcript: ENSMUST00000209608
Predicted Effect unknown
Transcript: ENSMUST00000210062
AA Change: S83P
Predicted Effect probably benign
Transcript: ENSMUST00000210816
Predicted Effect probably benign
Transcript: ENSMUST00000210830
AA Change: S109P

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211537
AA Change: S109P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit frequent exencephaly associated with neonatal lethality, rib cage abnormalities, and a low frequency of homeotic transformations of cervical segments but no presphenoid bone or cranial nerve defects; non-exencephalic survivors are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Deaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Deaf1 APN 7 141324181 critical splice acceptor site probably null
IGL02393:Deaf1 APN 7 141313333 missense possibly damaging 0.95
IGL03108:Deaf1 APN 7 141322961 missense probably damaging 1.00
IGL03344:Deaf1 APN 7 141297548 missense probably benign 0.08
Qball UTSW 7 141322468 missense probably damaging 1.00
R1702:Deaf1 UTSW 7 141314954 missense probably damaging 1.00
R2849:Deaf1 UTSW 7 141314454 makesense probably null
R4600:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4611:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4649:Deaf1 UTSW 7 141297573 missense possibly damaging 0.59
R4953:Deaf1 UTSW 7 141322468 missense probably damaging 1.00
R6349:Deaf1 UTSW 7 141322950 missense possibly damaging 0.74
R7168:Deaf1 UTSW 7 141324596 intron probably benign
R7186:Deaf1 UTSW 7 141327470 missense probably benign
R7343:Deaf1 UTSW 7 141322958 missense probably damaging 1.00
R7407:Deaf1 UTSW 7 141297579 missense possibly damaging 0.88
R8190:Deaf1 UTSW 7 141314411 missense probably damaging 1.00
R8692:Deaf1 UTSW 7 141297531 missense probably benign 0.04
Z1176:Deaf1 UTSW 7 141301474 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTTTCCTGCCTTGCCTGAGAG -3'
(R):5'- ATCGACAAGGAGGTGTCCTAGACC -3'

Sequencing Primer
(F):5'- TCCGAGAACTACAGGTGTTCAC -3'
(R):5'- AAGGGTAGAGATTCCCCTTTTC -3'
Posted On2014-04-13