Incidental Mutation 'R1543:Hyal2'
ID171935
Institutional Source Beutler Lab
Gene Symbol Hyal2
Ensembl Gene ENSMUSG00000010047
Gene Namehyaluronoglucosaminidase 2
Synonyms
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107567945-107572779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107570187 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 13 (L13P)
Ref Sequence ENSEMBL: ENSMUSP00000142207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010191] [ENSMUST00000010198] [ENSMUST00000192887] [ENSMUST00000193747] [ENSMUST00000194794] [ENSMUST00000195681] [ENSMUST00000195752]
Predicted Effect probably benign
Transcript: ENSMUST00000010191
AA Change: L13P

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000010191
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 29 362 9.6e-140 PFAM
EGF 364 439 4.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010198
SMART Domains Protein: ENSMUSP00000010198
Gene: ENSMUSG00000010054

DomainStartEndE-ValueType
Pfam:TUSC2 1 109 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192051
Predicted Effect probably damaging
Transcript: ENSMUST00000192887
AA Change: L13P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142207
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 82 5.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193747
AA Change: L13P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142141
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 342 5.4e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194628
Predicted Effect probably damaging
Transcript: ENSMUST00000194794
AA Change: L13P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142019
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 154 8.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195667
Predicted Effect probably damaging
Transcript: ENSMUST00000195681
AA Change: L13P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141820
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 325 3.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195752
AA Change: L13P

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141280
Gene: ENSMUSG00000010047
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 363 1.1e-144 PFAM
EGF 364 439 4.26e0 SMART
Meta Mutation Damage Score 0.8003 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, poor survival, craniofacial defects, and mild anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Hyal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Hyal2 APN 9 107570405 missense probably damaging 1.00
IGL00337:Hyal2 APN 9 107572172 missense probably damaging 1.00
IGL01834:Hyal2 APN 9 107570906 missense probably damaging 1.00
IGL02469:Hyal2 APN 9 107572212 missense probably damaging 1.00
R0505:Hyal2 UTSW 9 107572071 missense probably benign 0.28
R1078:Hyal2 UTSW 9 107572246 missense probably benign
R1858:Hyal2 UTSW 9 107572338 missense probably benign 0.01
R1974:Hyal2 UTSW 9 107572172 missense probably damaging 1.00
R3842:Hyal2 UTSW 9 107572121 missense probably damaging 0.99
R4400:Hyal2 UTSW 9 107570853 missense probably damaging 1.00
R5111:Hyal2 UTSW 9 107571111 missense probably benign 0.00
R5922:Hyal2 UTSW 9 107570907 missense probably damaging 1.00
R6026:Hyal2 UTSW 9 107572199 missense probably benign 0.00
R6266:Hyal2 UTSW 9 107570715 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTATCTCCCAAACCTGTTACAGCC -3'
(R):5'- AAAACCCTCATTCGGTGTAGCCTTC -3'

Sequencing Primer
(F):5'- TGTGCCGCACAGTATGG -3'
(R):5'- TTCACATCGAAGGCCCTAAGG -3'
Posted On2014-04-13