Mutagenetix > Incidental Mutations

Incidental Mutation 'R1543:Abca8b'

171945

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

039582-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1543 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 109974674 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 319 (M319R)

Ref Sequence

ENSEMBL: ENSMUSP00000020948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020948
AA Change: M319R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: M319R

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106669

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.4762

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.2%

Validation Efficiency

95% (77/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	G	A	6: 40,968,204	V206I	probably damaging	Het
2610507B11Rik	A	G	11: 78,275,174	T1422A	probably benign	Het
4933425L06Rik	A	T	13: 105,112,369	R364*	probably null	Het
Abcc6	T	C	7: 46,016,504	R231G	probably benign	Het
Acadm	A	G	3: 153,929,572	Y302H	probably damaging	Het
Acox3	C	A	5: 35,603,008	R423S	probably damaging	Het
Adam7	T	A	14: 68,521,922		probably benign	Het
Adgrb3	A	C	1: 25,488,088	M589R	probably benign	Het
Adgrl2	A	C	3: 148,859,273	F224V	probably damaging	Het
Adm2	G	C	15: 89,324,079	G74A	probably damaging	Het
Aen	T	A	7: 78,902,622	V15E	probably damaging	Het
Ankzf1	T	A	1: 75,192,516	V22D	possibly damaging	Het
Arap2	T	A	5: 62,606,155	K1549*	probably null	Het
Arhgef11	G	A	3: 87,713,017	R430H	probably benign	Het
Asb17	T	G	3: 153,844,511	L60W	probably damaging	Het
BC035044	T	C	6: 128,890,985		probably benign	Het
Cacna2d1	A	T	5: 16,266,718	M254L	possibly damaging	Het
Celf6	T	C	9: 59,603,877		probably benign	Het
Coro2b	C	T	9: 62,425,841	V120I	probably benign	Het
Cyp20a1	C	A	1: 60,376,194		probably benign	Het
Cyp2c67	C	A	19: 39,643,264		probably benign	Het
Dclk3	A	G	9: 111,468,054	H222R	probably benign	Het
Deaf1	A	G	7: 141,324,147	S109P	possibly damaging	Het
Dlg5	T	A	14: 24,144,448	D1675V	probably damaging	Het
Dsg2	T	A	18: 20,594,211	V605E	probably benign	Het
Frem2	A	T	3: 53,572,455	I1939N	possibly damaging	Het
Fsip2	A	T	2: 82,981,587	Y2750F	possibly damaging	Het
Gpr39	T	A	1: 125,872,424	I304N	probably damaging	Het
Hdac7	G	A	15: 97,809,529		probably benign	Het
Hipk1	T	C	3: 103,778,164	H45R	probably benign	Het
Hyal2	T	C	9: 107,570,187	L13P	probably damaging	Het
Kdm1b	C	T	13: 47,068,521	R479W	probably damaging	Het
Lilr4b	A	G	10: 51,481,421	T118A	probably damaging	Het
Lin7a	C	A	10: 107,412,069	F78L	possibly damaging	Het
Lpin3	A	G	2: 160,895,390	D119G	possibly damaging	Het
Lrp2	G	A	2: 69,500,730	R1661C	probably damaging	Het
Lrrc45	A	G	11: 120,720,018	K527E	probably benign	Het
Map10	C	T	8: 125,670,872	P335S	probably benign	Het
Mast3	A	G	8: 70,792,311	S2P	possibly damaging	Het
Mbtps1	A	G	8: 119,542,069		probably benign	Het
Mms22l	T	A	4: 24,591,084	N1018K	probably benign	Het
Nckipsd	C	A	9: 108,812,372	A244D	possibly damaging	Het
Olfr1294	A	G	2: 111,537,797	V164A	probably benign	Het
Olfr3	A	T	2: 36,813,057	F12I	probably damaging	Het
Olfr358	C	A	2: 37,005,127	L162F	probably damaging	Het
Olfr592	T	A	7: 103,187,214	F204L	probably benign	Het
Olfr876	T	A	9: 37,803,947	I12N	possibly damaging	Het
Pcx	A	T	19: 4,602,223	D112V	probably damaging	Het
Phf14	G	A	6: 11,987,683		probably null	Het
Pkd1l1	A	G	11: 8,901,200	I744T	probably damaging	Het
Ppip5k2	A	G	1: 97,740,882	L560P	probably damaging	Het
Psmd14	A	T	2: 61,785,530	M248L	probably benign	Het
Ryr1	T	G	7: 29,083,537	E1884A	possibly damaging	Het
Scn4b	T	A	9: 45,150,429	S204R	probably damaging	Het
Slc12a1	A	T	2: 125,184,857	M471L	possibly damaging	Het
Slc17a5	A	G	9: 78,560,800	V236A	probably benign	Het
Sobp	T	C	10: 43,021,724	T622A	probably damaging	Het
Spata31d1a	G	T	13: 59,702,242	R691S	probably benign	Het
Speg	A	G	1: 75,421,951	E2014G	probably damaging	Het
Steap4	A	G	5: 7,975,902		probably benign	Het
Tas2r144	G	A	6: 42,215,603	M92I	probably benign	Het
Tbc1d5	T	C	17: 50,935,532	Q179R	probably benign	Het
Tcf25	T	C	8: 123,388,587	Y188H	probably benign	Het
Tmem2	G	T	19: 21,812,573	A668S	probably benign	Het
Tmem200a	G	A	10: 26,078,620		probably benign	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Tssk5	T	C	15: 76,372,209	T337A	probably benign	Het
Ttc23	T	C	7: 67,678,995	V228A	probably benign	Het
Tulp1	A	T	17: 28,362,671		probably benign	Het
Uqcc3	A	G	19: 8,880,753	F25L	probably damaging	Het
Vmn2r1	G	A	3: 64,089,573	G217S	probably damaging	Het
Vmn2r120	C	T	17: 57,522,374	E508K	probably benign	Het
Wdfy3	C	A	5: 101,844,081	V3451L	probably benign	Het
Wdr19	G	A	5: 65,224,690	V418I	probably benign	Het
Wdr60	T	C	12: 116,231,784		probably benign	Het
Xirp2	C	T	2: 67,508,039	T208I	probably benign	Het
Xpnpep1	A	G	19: 52,991,676	V639A	probably benign	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TAGGTAACAGATCCTCACCTGGGC -3'
(R):5'- ACCAGCTTCATGGTGGTCTTTAGC -3'

Sequencing Primer
(F):5'- CCATTCCTAGTGTGAAGGCAAAG -3'
(R):5'- GAGTTGATTTAAAATTCCCCTTGCC -3'

Posted On

2014-04-13