Incidental Mutation 'R1543:Adam7'
ID171951
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 68521922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably benign
Transcript: ENSMUST00000022640
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 intron probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R7951:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ggtccTCATCAACTTAGACAGCAAGTG -3'
(R):5'- GCAGTGATGGTTAAACGATTGGGAGA -3'

Sequencing Primer
(F):5'- TTACCAGGTGGATCTGTGGT -3'
(R):5'- gttgttgttgttgttgttgctg -3'
Posted On2014-04-13