Mutagenetix > Incidental Mutation

Incidental Mutation 'R1543:Dsg2'

171960

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

039582-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R1543 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20594211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 605 (V605E)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787]

AlphaFold

O55111

Predicted Effect

probably benign
Transcript: ENSMUST00000059787
AA Change: V605E

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V605E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130296

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.2%

Validation Efficiency

95% (77/81)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	G	A	6: 40,968,204	V206I	probably damaging	Het
2610507B11Rik	A	G	11: 78,275,174	T1422A	probably benign	Het
4933425L06Rik	A	T	13: 105,112,369	R364*	probably null	Het
Abca8b	A	C	11: 109,974,674	M319R	probably damaging	Het
Abcc6	T	C	7: 46,016,504	R231G	probably benign	Het
Acadm	A	G	3: 153,929,572	Y302H	probably damaging	Het
Acox3	C	A	5: 35,603,008	R423S	probably damaging	Het
Adam7	T	A	14: 68,521,922		probably benign	Het
Adgrb3	A	C	1: 25,488,088	M589R	probably benign	Het
Adgrl2	A	C	3: 148,859,273	F224V	probably damaging	Het
Adm2	G	C	15: 89,324,079	G74A	probably damaging	Het
Aen	T	A	7: 78,902,622	V15E	probably damaging	Het
Ankzf1	T	A	1: 75,192,516	V22D	possibly damaging	Het
Arap2	T	A	5: 62,606,155	K1549*	probably null	Het
Arhgef11	G	A	3: 87,713,017	R430H	probably benign	Het
Asb17	T	G	3: 153,844,511	L60W	probably damaging	Het
BC035044	T	C	6: 128,890,985		probably benign	Het
Cacna2d1	A	T	5: 16,266,718	M254L	possibly damaging	Het
Celf6	T	C	9: 59,603,877		probably benign	Het
Coro2b	C	T	9: 62,425,841	V120I	probably benign	Het
Cyp20a1	C	A	1: 60,376,194		probably benign	Het
Cyp2c67	C	A	19: 39,643,264		probably benign	Het
Dclk3	A	G	9: 111,468,054	H222R	probably benign	Het
Deaf1	A	G	7: 141,324,147	S109P	possibly damaging	Het
Dlg5	T	A	14: 24,144,448	D1675V	probably damaging	Het
Frem2	A	T	3: 53,572,455	I1939N	possibly damaging	Het
Fsip2	A	T	2: 82,981,587	Y2750F	possibly damaging	Het
Gpr39	T	A	1: 125,872,424	I304N	probably damaging	Het
Hdac7	G	A	15: 97,809,529		probably benign	Het
Hipk1	T	C	3: 103,778,164	H45R	probably benign	Het
Hyal2	T	C	9: 107,570,187	L13P	probably damaging	Het
Kdm1b	C	T	13: 47,068,521	R479W	probably damaging	Het
Lilr4b	A	G	10: 51,481,421	T118A	probably damaging	Het
Lin7a	C	A	10: 107,412,069	F78L	possibly damaging	Het
Lpin3	A	G	2: 160,895,390	D119G	possibly damaging	Het
Lrp2	G	A	2: 69,500,730	R1661C	probably damaging	Het
Lrrc45	A	G	11: 120,720,018	K527E	probably benign	Het
Map10	C	T	8: 125,670,872	P335S	probably benign	Het
Mast3	A	G	8: 70,792,311	S2P	possibly damaging	Het
Mbtps1	A	G	8: 119,542,069		probably benign	Het
Mms22l	T	A	4: 24,591,084	N1018K	probably benign	Het
Nckipsd	C	A	9: 108,812,372	A244D	possibly damaging	Het
Olfr1294	A	G	2: 111,537,797	V164A	probably benign	Het
Olfr3	A	T	2: 36,813,057	F12I	probably damaging	Het
Olfr358	C	A	2: 37,005,127	L162F	probably damaging	Het
Olfr592	T	A	7: 103,187,214	F204L	probably benign	Het
Olfr876	T	A	9: 37,803,947	I12N	possibly damaging	Het
Pcx	A	T	19: 4,602,223	D112V	probably damaging	Het
Phf14	G	A	6: 11,987,683		probably null	Het
Pkd1l1	A	G	11: 8,901,200	I744T	probably damaging	Het
Ppip5k2	A	G	1: 97,740,882	L560P	probably damaging	Het
Psmd14	A	T	2: 61,785,530	M248L	probably benign	Het
Ryr1	T	G	7: 29,083,537	E1884A	possibly damaging	Het
Scn4b	T	A	9: 45,150,429	S204R	probably damaging	Het
Slc12a1	A	T	2: 125,184,857	M471L	possibly damaging	Het
Slc17a5	A	G	9: 78,560,800	V236A	probably benign	Het
Sobp	T	C	10: 43,021,724	T622A	probably damaging	Het
Spata31d1a	G	T	13: 59,702,242	R691S	probably benign	Het
Speg	A	G	1: 75,421,951	E2014G	probably damaging	Het
Steap4	A	G	5: 7,975,902		probably benign	Het
Tas2r144	G	A	6: 42,215,603	M92I	probably benign	Het
Tbc1d5	T	C	17: 50,935,532	Q179R	probably benign	Het
Tcf25	T	C	8: 123,388,587	Y188H	probably benign	Het
Tmem2	G	T	19: 21,812,573	A668S	probably benign	Het
Tmem200a	G	A	10: 26,078,620		probably benign	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Tssk5	T	C	15: 76,372,209	T337A	probably benign	Het
Ttc23	T	C	7: 67,678,995	V228A	probably benign	Het
Tulp1	A	T	17: 28,362,671		probably benign	Het
Uqcc3	A	G	19: 8,880,753	F25L	probably damaging	Het
Vmn2r1	G	A	3: 64,089,573	G217S	probably damaging	Het
Vmn2r120	C	T	17: 57,522,374	E508K	probably benign	Het
Wdfy3	C	A	5: 101,844,081	V3451L	probably benign	Het
Wdr19	G	A	5: 65,224,690	V418I	probably benign	Het
Wdr60	T	C	12: 116,231,784		probably benign	Het
Xirp2	C	T	2: 67,508,039	T208I	probably benign	Het
Xpnpep1	A	G	19: 52,991,676	V639A	probably benign	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCGTGAAAGCTGTGTCCAACC -3'
(R):5'- TGTGGCAAGTCCTTTCTGAAGACC -3'

Sequencing Primer
(F):5'- GACACATTTTTGGTGAGCACAG -3'
(R):5'- TTCTGAAGACCTATTGACACCG -3'

Posted On

2014-04-13