Incidental Mutation 'R1543:Dsg2'
ID171960
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R1543 (G1)
Quality Score204
Status Validated
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20594211 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 605 (V605E)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
Predicted Effect probably benign
Transcript: ENSMUST00000059787
AA Change: V605E

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V605E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130296
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably benign
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R8094:Dsg2 UTSW 18 20583004 unclassified probably benign
R8118:Dsg2 UTSW 18 20582801 missense probably benign 0.11
R8157:Dsg2 UTSW 18 20580549 missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8308:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8488:Dsg2 UTSW 18 20601374 missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20579451 missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20590075 missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20601918 missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20575012 missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20582999 missense probably damaging 1.00
Z1176:Dsg2 UTSW 18 20580621 missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20602249 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGTGAAAGCTGTGTCCAACC -3'
(R):5'- TGTGGCAAGTCCTTTCTGAAGACC -3'

Sequencing Primer
(F):5'- GACACATTTTTGGTGAGCACAG -3'
(R):5'- TTCTGAAGACCTATTGACACCG -3'
Posted On2014-04-13