Incidental Mutation 'R1544:Fer1l4'
ID 171984
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 039583-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1544 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155887553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 548 (M548V)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: M548V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: M548V

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,147,543 (GRCm39) I182T possibly damaging Het
4933406P04Rik A G 10: 20,187,105 (GRCm39) probably benign Het
A730018C14Rik A G 12: 112,381,924 (GRCm39) noncoding transcript Het
Aacs A T 5: 125,593,394 (GRCm39) I666F possibly damaging Het
Abcb9 C T 5: 124,221,694 (GRCm39) V227I probably benign Het
Abcd3 T C 3: 121,578,122 (GRCm39) Q168R probably benign Het
Adamts4 A G 1: 171,080,311 (GRCm39) Q288R probably benign Het
Atad2 G A 15: 57,966,760 (GRCm39) A611V probably damaging Het
Aup1 T C 6: 83,032,187 (GRCm39) V118A possibly damaging Het
Bend7 T A 2: 4,768,122 (GRCm39) probably benign Het
Brd4 A G 17: 32,417,646 (GRCm39) probably benign Het
C4b C A 17: 34,957,941 (GRCm39) R580L probably benign Het
Cct8 G T 16: 87,288,342 (GRCm39) probably benign Het
Cfhr4 A T 1: 139,664,608 (GRCm39) C484S probably damaging Het
Cilp T C 9: 65,183,127 (GRCm39) Y344H probably benign Het
Clic6 A T 16: 92,288,961 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,703 (GRCm39) S247P probably damaging Het
Csf2rb G T 15: 78,224,955 (GRCm39) A212S probably benign Het
Csmd3 A C 15: 47,475,294 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,679,393 (GRCm39) D366G probably benign Het
Dhx33 A G 11: 70,890,354 (GRCm39) S222P probably damaging Het
Dhx40 T A 11: 86,697,379 (GRCm39) I63F possibly damaging Het
Dipk2b A C X: 18,286,701 (GRCm39) L285V possibly damaging Het
Dlgap2 T A 8: 14,879,861 (GRCm39) probably null Het
Dnah7b T A 1: 46,105,957 (GRCm39) D20E unknown Het
Dnase2b C A 3: 146,290,312 (GRCm39) A220S probably benign Het
Dock10 T C 1: 80,570,352 (GRCm39) E362G probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Epha10 C A 4: 124,779,389 (GRCm39) N78K probably damaging Het
Epha3 A G 16: 63,593,416 (GRCm39) V224A probably damaging Het
Fcgr4 C A 1: 170,847,523 (GRCm39) D40E probably damaging Het
Flii C T 11: 60,610,518 (GRCm39) probably null Het
Flnc A T 6: 29,444,079 (GRCm39) Y631F probably benign Het
Gm6871 A C 7: 41,195,514 (GRCm39) probably null Het
Gtf2ird1 A T 5: 134,387,772 (GRCm39) S1028T possibly damaging Het
Hycc1 A T 5: 24,170,139 (GRCm39) D403E probably benign Het
Hydin A G 8: 111,301,486 (GRCm39) H3739R probably benign Het
Iqcg A T 16: 32,865,895 (GRCm39) N149K probably benign Het
Iqgap3 A G 3: 88,006,200 (GRCm39) D537G probably benign Het
Itih2 T G 2: 10,110,025 (GRCm39) D576A probably benign Het
Kcmf1 T C 6: 72,825,212 (GRCm39) T243A probably benign Het
Kif1a A G 1: 93,002,670 (GRCm39) probably benign Het
Klf10 C T 15: 38,297,030 (GRCm39) G337S probably damaging Het
Krt31 T C 11: 99,938,699 (GRCm39) N298S possibly damaging Het
Lmnb1 A G 18: 56,882,823 (GRCm39) E556G probably benign Het
Mael A T 1: 166,029,859 (GRCm39) S354T probably benign Het
Mast3 T C 8: 71,238,816 (GRCm39) D496G probably damaging Het
Med12l A G 3: 59,172,661 (GRCm39) T1806A possibly damaging Het
Mms19 A G 19: 41,944,260 (GRCm39) probably null Het
Moap1 A T 12: 102,709,504 (GRCm39) M15K possibly damaging Het
Mpv17l G T 16: 13,764,683 (GRCm39) W70L probably damaging Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myo7b T C 18: 32,127,962 (GRCm39) I577V probably benign Het
Myo9b T A 8: 71,743,620 (GRCm39) L227Q probably damaging Het
Myom2 T C 8: 15,154,059 (GRCm39) probably benign Het
Naip6 C A 13: 100,452,983 (GRCm39) R26L probably benign Het
Nbea T C 3: 55,966,248 (GRCm39) T405A probably damaging Het
Nrp2 T A 1: 62,802,063 (GRCm39) I502N probably damaging Het
Nt5el A T 13: 105,246,129 (GRCm39) H230L probably benign Het
Nufip2 G A 11: 77,582,733 (GRCm39) E216K possibly damaging Het
Oaf A G 9: 43,133,930 (GRCm39) Y264H probably damaging Het
Or51a42 A G 7: 103,708,431 (GRCm39) V126A probably damaging Het
Or5m10 T C 2: 85,717,615 (GRCm39) L157P probably damaging Het
Or6c217 A T 10: 129,738,293 (GRCm39) C95* probably null Het
Pax1 T C 2: 147,210,321 (GRCm39) V352A probably damaging Het
Pkd1l2 TGGG TGG 8: 117,764,974 (GRCm39) probably null Het
Plxna3 G A X: 73,383,772 (GRCm39) probably null Het
Pnpla3 T C 15: 84,065,247 (GRCm39) V347A probably benign Het
Ppl T A 16: 4,920,461 (GRCm39) K350* probably null Het
Pramel28 T C 4: 143,692,632 (GRCm39) D123G probably benign Het
Prb1a T A 6: 132,186,424 (GRCm39) probably null Het
Prb1a C A 6: 132,186,423 (GRCm39) probably null Het
Ptpn11 G A 5: 121,275,574 (GRCm39) H540Y probably benign Het
Ptprz1 C A 6: 23,000,747 (GRCm39) H946N possibly damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rad51b A G 12: 79,349,317 (GRCm39) E51G possibly damaging Het
Rin2 T C 2: 145,700,366 (GRCm39) V181A probably damaging Het
Rnf157 T A 11: 116,245,188 (GRCm39) probably null Het
Rnf207 A G 4: 152,398,328 (GRCm39) probably benign Het
Ror1 A T 4: 100,299,183 (GRCm39) K852M probably damaging Het
Sbp T A 17: 24,164,043 (GRCm39) I102K probably benign Het
Scaf8 T C 17: 3,195,429 (GRCm39) I33T probably damaging Het
Scn5a C T 9: 119,315,699 (GRCm39) V1670I probably damaging Het
Serhl C T 15: 82,989,877 (GRCm39) T42M probably damaging Het
Sin3a A G 9: 57,011,281 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,012,374 (GRCm39) S166G probably benign Het
Slc15a4 G A 5: 127,680,832 (GRCm39) H396Y probably benign Het
Slc2a7 A T 4: 150,239,143 (GRCm39) N123Y probably damaging Het
Smpd3 G A 8: 106,992,199 (GRCm39) T118M possibly damaging Het
Spns2 A T 11: 72,347,193 (GRCm39) I427N probably benign Het
Ssmem1 T A 6: 30,519,650 (GRCm39) S112T probably damaging Het
Stard10 A T 7: 100,993,233 (GRCm39) D190V probably damaging Het
Stil A T 4: 114,881,049 (GRCm39) K531M probably damaging Het
Strc T C 2: 121,203,219 (GRCm39) probably null Het
Svil T A 18: 5,046,817 (GRCm39) I21N possibly damaging Het
Syt11 T C 3: 88,656,110 (GRCm39) M14V probably benign Het
Tasor2 A T 13: 3,640,413 (GRCm39) H241Q possibly damaging Het
Tg A T 15: 66,577,081 (GRCm39) Q1468L probably benign Het
Tjp1 A G 7: 64,952,669 (GRCm39) V1555A probably benign Het
Tmprss11d A C 5: 86,486,658 (GRCm39) S77R probably damaging Het
Tsnaxip1 A G 8: 106,554,383 (GRCm39) probably benign Het
Tyr C A 7: 87,141,914 (GRCm39) L138F probably damaging Het
Ubash3b A G 9: 40,927,901 (GRCm39) V469A probably damaging Het
Ugt8a T C 3: 125,709,098 (GRCm39) Y4C probably benign Het
Vmn1r201 A T 13: 22,658,968 (GRCm39) T61S probably benign Het
Vmn1r204 A G 13: 22,740,465 (GRCm39) H32R probably benign Het
Vmn1r228 T A 17: 20,997,285 (GRCm39) I78L probably benign Het
Wdr90 T C 17: 26,068,284 (GRCm39) D1348G possibly damaging Het
Zfp563 T A 17: 33,324,187 (GRCm39) C261S probably benign Het
Zfp809 T A 9: 22,146,395 (GRCm39) L28Q probably damaging Het
Znrf3 T A 11: 5,239,066 (GRCm39) Q99L probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACTGGCAGGCTGTAAAATG -3'
(R):5'- CGTGACAATGCACCTCTTGTGGATG -3'

Sequencing Primer
(F):5'- GCTGTAAAATGCCAGCCG -3'
(R):5'- CTGAGGCAGATCTCGAACTC -3'
Posted On 2014-04-13