Incidental Mutation 'R1544:Spns2'
ID172043
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission 039583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1544 (G1)
Quality Score199
Status Validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72456367 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 427 (I427N)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
Predicted Effect probably benign
Transcript: ENSMUST00000045303
AA Change: I427N

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: I427N

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect unknown
Transcript: ENSMUST00000144940
AA Change: I41N
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447
AA Change: I41N

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Meta Mutation Damage Score 0.1711 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A C X: 18,420,462 L285V possibly damaging Het
4931406B18Rik A G 7: 43,498,119 I182T possibly damaging Het
4933406P04Rik A G 10: 20,311,359 probably benign Het
4933425L06Rik A T 13: 105,109,621 H230L probably benign Het
A730018C14Rik A G 12: 112,415,490 noncoding transcript Het
Aacs A T 5: 125,516,330 I666F possibly damaging Het
Abcb9 C T 5: 124,083,631 V227I probably benign Het
Abcd3 T C 3: 121,784,473 Q168R probably benign Het
Adamts4 A G 1: 171,252,742 Q288R probably benign Het
Atad2 G A 15: 58,103,364 A611V probably damaging Het
Aup1 T C 6: 83,055,206 V118A possibly damaging Het
Bend7 T A 2: 4,763,311 probably benign Het
Brd4 A G 17: 32,198,672 probably benign Het
C4b C A 17: 34,738,967 R580L probably benign Het
Cct8 G T 16: 87,491,454 probably benign Het
Cilp T C 9: 65,275,845 Y344H probably benign Het
Clic6 A T 16: 92,492,073 probably benign Het
Colgalt2 T C 1: 152,484,952 S247P probably damaging Het
Csf2rb G T 15: 78,340,755 A212S probably benign Het
Csmd3 A C 15: 47,611,898 probably null Het
Cyp26c1 A G 19: 37,690,945 D366G probably benign Het
Dhx33 A G 11: 70,999,528 S222P probably damaging Het
Dhx40 T A 11: 86,806,553 I63F possibly damaging Het
Dlgap2 T A 8: 14,829,861 probably null Het
Dnah7b T A 1: 46,066,797 D20E unknown Het
Dnase2b C A 3: 146,584,557 A220S probably benign Het
Dock10 T C 1: 80,592,635 E362G probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Epha10 C A 4: 124,885,596 N78K probably damaging Het
Epha3 A G 16: 63,773,053 V224A probably damaging Het
Fam126a A T 5: 23,965,141 D403E probably benign Het
Fam208b A T 13: 3,590,413 H241Q possibly damaging Het
Fcgr4 C A 1: 171,019,954 D40E probably damaging Het
Fer1l4 T C 2: 156,045,633 M548V probably benign Het
Flii C T 11: 60,719,692 probably null Het
Flnc A T 6: 29,444,080 Y631F probably benign Het
Gm13101 T C 4: 143,966,062 D123G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4788 A T 1: 139,736,870 C484S probably damaging Het
Gm6871 A C 7: 41,546,090 probably null Het
Gtf2ird1 A T 5: 134,358,918 S1028T possibly damaging Het
Hydin A G 8: 110,574,854 H3739R probably benign Het
Iqcg A T 16: 33,045,525 N149K probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Itih2 T G 2: 10,105,214 D576A probably benign Het
Kcmf1 T C 6: 72,848,229 T243A probably benign Het
Kif1a A G 1: 93,074,948 probably benign Het
Klf10 C T 15: 38,296,786 G337S probably damaging Het
Krt31 T C 11: 100,047,873 N298S possibly damaging Het
Lmnb1 A G 18: 56,749,751 E556G probably benign Het
Mael A T 1: 166,202,290 S354T probably benign Het
Mast3 T C 8: 70,786,172 D496G probably damaging Het
Med12l A G 3: 59,265,240 T1806A possibly damaging Het
Mms19 A G 19: 41,955,821 probably null Het
Moap1 A T 12: 102,743,245 M15K possibly damaging Het
Mpv17l G T 16: 13,946,819 W70L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myo9b T A 8: 71,290,976 L227Q probably damaging Het
Myom2 T C 8: 15,104,059 probably benign Het
Naip6 C A 13: 100,316,475 R26L probably benign Het
Nbea T C 3: 56,058,827 T405A probably damaging Het
Nrp2 T A 1: 62,762,904 I502N probably damaging Het
Nufip2 G A 11: 77,691,907 E216K possibly damaging Het
Oaf A G 9: 43,222,633 Y264H probably damaging Het
Olfr1023 T C 2: 85,887,271 L157P probably damaging Het
Olfr643 A G 7: 104,059,224 V126A probably damaging Het
Olfr815 A T 10: 129,902,424 C95* probably null Het
Pax1 T C 2: 147,368,401 V352A probably damaging Het
Pkd1l2 TGGG TGG 8: 117,038,235 probably null Het
Plxna3 G A X: 74,340,166 probably null Het
Pnpla3 T C 15: 84,181,046 V347A probably benign Het
Ppl T A 16: 5,102,597 K350* probably null Het
Prb1 C A 6: 132,209,460 probably null Het
Prb1 T A 6: 132,209,461 probably null Het
Ptpn11 G A 5: 121,137,511 H540Y probably benign Het
Ptprz1 C A 6: 23,000,748 H946N possibly damaging Het
Rad51b A G 12: 79,302,543 E51G possibly damaging Het
Rin2 T C 2: 145,858,446 V181A probably damaging Het
Rnf157 T A 11: 116,354,362 probably null Het
Rnf207 A G 4: 152,313,871 probably benign Het
Ror1 A T 4: 100,441,986 K852M probably damaging Het
Sbp T A 17: 23,945,069 I102K probably benign Het
Scaf8 T C 17: 3,145,154 I33T probably damaging Het
Scn5a C T 9: 119,486,633 V1670I probably damaging Het
Serhl C T 15: 83,105,676 T42M probably damaging Het
Sin3a A G 9: 57,103,997 probably benign Het
Slc12a2 A G 18: 57,879,302 S166G probably benign Het
Slc15a4 G A 5: 127,603,768 H396Y probably benign Het
Slc2a7 A T 4: 150,154,686 N123Y probably damaging Het
Smpd3 G A 8: 106,265,567 T118M possibly damaging Het
Ssmem1 T A 6: 30,519,651 S112T probably damaging Het
Stard10 A T 7: 101,344,026 D190V probably damaging Het
Stil A T 4: 115,023,852 K531M probably damaging Het
Strc T C 2: 121,372,738 probably null Het
Svil T A 18: 5,046,817 I21N possibly damaging Het
Syt11 T C 3: 88,748,803 M14V probably benign Het
Tg A T 15: 66,705,232 Q1468L probably benign Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmprss11d A C 5: 86,338,799 S77R probably damaging Het
Tsnaxip1 A G 8: 105,827,751 probably benign Het
Tyr C A 7: 87,492,706 L138F probably damaging Het
Ubash3b A G 9: 41,016,605 V469A probably damaging Het
Ugt8a T C 3: 125,915,449 Y4C probably benign Het
Vmn1r201 A T 13: 22,474,798 T61S probably benign Het
Vmn1r204 A G 13: 22,556,295 H32R probably benign Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Wdr90 T C 17: 25,849,310 D1348G possibly damaging Het
Zfp563 T A 17: 33,105,213 C261S probably benign Het
Zfp809 T A 9: 22,235,099 L28Q probably damaging Het
Znrf3 T A 11: 5,289,066 Q99L probably damaging Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
R8553:Spns2 UTSW 11 72457227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCAGCAAGTACTGCTTATTC -3'
(R):5'- ACAGCCTCATCTTTGGAGCCATTAC -3'

Sequencing Primer
(F):5'- GCAGCAAGTACTGCTTATTCTTCAC -3'
(R):5'- CAACGTGCTGACCCATTG -3'
Posted On2014-04-13