Incidental Mutation 'R1544:Tg'
ID172059
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission 039583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1544 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66705232 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1468 (Q1468L)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495]
Predicted Effect probably benign
Transcript: ENSMUST00000065916
AA Change: Q1468L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: Q1468L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167512
Meta Mutation Damage Score 0.0943 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A C X: 18,420,462 L285V possibly damaging Het
4931406B18Rik A G 7: 43,498,119 I182T possibly damaging Het
4933406P04Rik A G 10: 20,311,359 probably benign Het
4933425L06Rik A T 13: 105,109,621 H230L probably benign Het
A730018C14Rik A G 12: 112,415,490 noncoding transcript Het
Aacs A T 5: 125,516,330 I666F possibly damaging Het
Abcb9 C T 5: 124,083,631 V227I probably benign Het
Abcd3 T C 3: 121,784,473 Q168R probably benign Het
Adamts4 A G 1: 171,252,742 Q288R probably benign Het
Atad2 G A 15: 58,103,364 A611V probably damaging Het
Aup1 T C 6: 83,055,206 V118A possibly damaging Het
Bend7 T A 2: 4,763,311 probably benign Het
Brd4 A G 17: 32,198,672 probably benign Het
C4b C A 17: 34,738,967 R580L probably benign Het
Cct8 G T 16: 87,491,454 probably benign Het
Cilp T C 9: 65,275,845 Y344H probably benign Het
Clic6 A T 16: 92,492,073 probably benign Het
Colgalt2 T C 1: 152,484,952 S247P probably damaging Het
Csf2rb G T 15: 78,340,755 A212S probably benign Het
Csmd3 A C 15: 47,611,898 probably null Het
Cyp26c1 A G 19: 37,690,945 D366G probably benign Het
Dhx33 A G 11: 70,999,528 S222P probably damaging Het
Dhx40 T A 11: 86,806,553 I63F possibly damaging Het
Dlgap2 T A 8: 14,829,861 probably null Het
Dnah7b T A 1: 46,066,797 D20E unknown Het
Dnase2b C A 3: 146,584,557 A220S probably benign Het
Dock10 T C 1: 80,592,635 E362G probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Epha10 C A 4: 124,885,596 N78K probably damaging Het
Epha3 A G 16: 63,773,053 V224A probably damaging Het
Fam126a A T 5: 23,965,141 D403E probably benign Het
Fam208b A T 13: 3,590,413 H241Q possibly damaging Het
Fcgr4 C A 1: 171,019,954 D40E probably damaging Het
Fer1l4 T C 2: 156,045,633 M548V probably benign Het
Flii C T 11: 60,719,692 probably null Het
Flnc A T 6: 29,444,080 Y631F probably benign Het
Gm13101 T C 4: 143,966,062 D123G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4788 A T 1: 139,736,870 C484S probably damaging Het
Gm6871 A C 7: 41,546,090 probably null Het
Gtf2ird1 A T 5: 134,358,918 S1028T possibly damaging Het
Hydin A G 8: 110,574,854 H3739R probably benign Het
Iqcg A T 16: 33,045,525 N149K probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Itih2 T G 2: 10,105,214 D576A probably benign Het
Kcmf1 T C 6: 72,848,229 T243A probably benign Het
Kif1a A G 1: 93,074,948 probably benign Het
Klf10 C T 15: 38,296,786 G337S probably damaging Het
Krt31 T C 11: 100,047,873 N298S possibly damaging Het
Lmnb1 A G 18: 56,749,751 E556G probably benign Het
Mael A T 1: 166,202,290 S354T probably benign Het
Mast3 T C 8: 70,786,172 D496G probably damaging Het
Med12l A G 3: 59,265,240 T1806A possibly damaging Het
Mms19 A G 19: 41,955,821 probably null Het
Moap1 A T 12: 102,743,245 M15K possibly damaging Het
Mpv17l G T 16: 13,946,819 W70L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myo9b T A 8: 71,290,976 L227Q probably damaging Het
Myom2 T C 8: 15,104,059 probably benign Het
Naip6 C A 13: 100,316,475 R26L probably benign Het
Nbea T C 3: 56,058,827 T405A probably damaging Het
Nrp2 T A 1: 62,762,904 I502N probably damaging Het
Nufip2 G A 11: 77,691,907 E216K possibly damaging Het
Oaf A G 9: 43,222,633 Y264H probably damaging Het
Olfr1023 T C 2: 85,887,271 L157P probably damaging Het
Olfr643 A G 7: 104,059,224 V126A probably damaging Het
Olfr815 A T 10: 129,902,424 C95* probably null Het
Pax1 T C 2: 147,368,401 V352A probably damaging Het
Pkd1l2 TGGG TGG 8: 117,038,235 probably null Het
Plxna3 G A X: 74,340,166 probably null Het
Pnpla3 T C 15: 84,181,046 V347A probably benign Het
Ppl T A 16: 5,102,597 K350* probably null Het
Prb1 C A 6: 132,209,460 probably null Het
Prb1 T A 6: 132,209,461 probably null Het
Ptpn11 G A 5: 121,137,511 H540Y probably benign Het
Ptprz1 C A 6: 23,000,748 H946N possibly damaging Het
Rad51b A G 12: 79,302,543 E51G possibly damaging Het
Rin2 T C 2: 145,858,446 V181A probably damaging Het
Rnf157 T A 11: 116,354,362 probably null Het
Rnf207 A G 4: 152,313,871 probably benign Het
Ror1 A T 4: 100,441,986 K852M probably damaging Het
Sbp T A 17: 23,945,069 I102K probably benign Het
Scaf8 T C 17: 3,145,154 I33T probably damaging Het
Scn5a C T 9: 119,486,633 V1670I probably damaging Het
Serhl C T 15: 83,105,676 T42M probably damaging Het
Sin3a A G 9: 57,103,997 probably benign Het
Slc12a2 A G 18: 57,879,302 S166G probably benign Het
Slc15a4 G A 5: 127,603,768 H396Y probably benign Het
Slc2a7 A T 4: 150,154,686 N123Y probably damaging Het
Smpd3 G A 8: 106,265,567 T118M possibly damaging Het
Spns2 A T 11: 72,456,367 I427N probably benign Het
Ssmem1 T A 6: 30,519,651 S112T probably damaging Het
Stard10 A T 7: 101,344,026 D190V probably damaging Het
Stil A T 4: 115,023,852 K531M probably damaging Het
Strc T C 2: 121,372,738 probably null Het
Svil T A 18: 5,046,817 I21N possibly damaging Het
Syt11 T C 3: 88,748,803 M14V probably benign Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmprss11d A C 5: 86,338,799 S77R probably damaging Het
Tsnaxip1 A G 8: 105,827,751 probably benign Het
Tyr C A 7: 87,492,706 L138F probably damaging Het
Ubash3b A G 9: 41,016,605 V469A probably damaging Het
Ugt8a T C 3: 125,915,449 Y4C probably benign Het
Vmn1r201 A T 13: 22,474,798 T61S probably benign Het
Vmn1r204 A G 13: 22,556,295 H32R probably benign Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Wdr90 T C 17: 25,849,310 D1348G possibly damaging Het
Zfp563 T A 17: 33,105,213 C261S probably benign Het
Zfp809 T A 9: 22,235,099 L28Q probably damaging Het
Znrf3 T A 11: 5,289,066 Q99L probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCCTTAACTTTTGAGCCCAAGGCTG -3'
(R):5'- ATCTCTGGCACTGATGCTGAGCAG -3'

Sequencing Primer
(F):5'- AGGCTGCCCACTTTTCATTAATTTC -3'
(R):5'- GTGCTACAGCCCTCTGTGTG -3'
Posted On2014-04-13