Incidental Mutation 'R1545:Rpe'
ID172084
Institutional Source Beutler Lab
Gene Symbol Rpe
Ensembl Gene ENSMUSG00000026005
Gene Nameribulose-5-phosphate-3-epimerase
Synonyms
MMRRC Submission 039584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1545 (G1)
Quality Score84
Status Not validated
Chromosome1
Chromosomal Location66700831-66719805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66701010 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 35 (H35R)
Ref Sequence ENSEMBL: ENSMUSP00000137860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027157] [ENSMUST00000061620] [ENSMUST00000113995] [ENSMUST00000142920] [ENSMUST00000151016] [ENSMUST00000190404] [ENSMUST00000212557]
Predicted Effect probably damaging
Transcript: ENSMUST00000027157
AA Change: H35R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027157
Gene: ENSMUSG00000026005
AA Change: H35R

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 204 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061620
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113995
AA Change: H35R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109628
Gene: ENSMUSG00000026005
AA Change: H35R

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 208 1.1e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142920
AA Change: H35R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137941
Gene: ENSMUSG00000026005
AA Change: H35R

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 49 3.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151016
AA Change: H35R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000152844
SMART Domains Protein: ENSMUSP00000117070
Gene: ENSMUSG00000055567

DomainStartEndE-ValueType
low complexity region 76 99 N/A INTRINSIC
low complexity region 200 209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190404
AA Change: H35R
SMART Domains Protein: ENSMUSP00000140257
Gene: ENSMUSG00000026005
AA Change: H35R

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 45 1.8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212557
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C A 5: 98,329,432 Q27K probably benign Het
Aaas C T 15: 102,339,206 R410H probably damaging Het
Abca2 T C 2: 25,442,358 C1468R probably benign Het
Actl9 T A 17: 33,433,257 I97N probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asb3 T A 11: 31,056,217 M234K probably benign Het
Bax A C 7: 45,461,933 H168Q probably null Het
Brinp1 A G 4: 68,762,955 L446P possibly damaging Het
Cdc14a A G 3: 116,293,724 probably null Het
Cpq A T 15: 33,250,000 I168F probably damaging Het
Crkl A T 16: 17,483,692 N270I probably damaging Het
Cul7 G A 17: 46,651,553 E37K probably damaging Het
Eps15 C T 4: 109,312,329 T112I probably benign Het
F5 C T 1: 164,208,960 R1897* probably null Het
Fam160a1 C T 3: 85,665,954 S896N probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Gm884 T C 11: 103,608,919 K615E probably benign Het
Gprc5a C A 6: 135,083,461 T316K probably damaging Het
Hectd4 T A 5: 121,323,956 L2299Q possibly damaging Het
Khdc3 C G 9: 73,103,660 P240R probably benign Het
Kif20b A G 19: 34,928,918 T69A probably damaging Het
Kptn C G 7: 16,123,963 Q239E probably benign Het
Lep T C 6: 29,070,832 S52P probably damaging Het
Lrig3 G A 10: 126,008,547 V627M possibly damaging Het
Mdga1 G A 17: 29,842,902 R792C probably damaging Het
Mink1 T C 11: 70,598,891 V58A possibly damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nrg3 T A 14: 38,407,154 I375F probably benign Het
Nup50 A G 15: 84,939,792 T449A possibly damaging Het
Nup98 A G 7: 102,134,880 S1082P possibly damaging Het
Olfr904 C A 9: 38,464,519 H159Q probably benign Het
Otub1 T C 19: 7,199,206 I188V probably benign Het
Pcdhac2 T C 18: 37,146,133 I722T possibly damaging Het
Pcsk7 T A 9: 45,914,348 D292E probably damaging Het
Peli2 T A 14: 48,252,717 D215E probably benign Het
Ppp1r9a T C 6: 5,156,242 probably null Het
Ppp2r1b A G 9: 50,862,425 K136R possibly damaging Het
Prpf3 T C 3: 95,847,803 K157E probably damaging Het
Prss50 T C 9: 110,861,268 S160P probably damaging Het
Ptprb T C 10: 116,380,869 V2251A probably damaging Het
Rgs6 G A 12: 83,116,177 E386K probably damaging Het
Rida A G 15: 34,495,104 I5T probably benign Het
Sema4b T A 7: 80,219,023 D321E probably benign Het
Slc22a13 G A 9: 119,209,047 A5V probably benign Het
Snta1 C T 2: 154,377,006 probably null Het
Spdye4c T A 2: 128,595,712 N220K probably benign Het
Sult1c1 G T 17: 53,962,148 A280E possibly damaging Het
Tfr2 A G 5: 137,583,299 E579G probably benign Het
Tmem221 A G 8: 71,558,538 L91P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Vmn1r17 A G 6: 57,361,332 V16A probably benign Het
Vmn1r188 A G 13: 22,088,433 R186G probably damaging Het
Wfikkn1 A G 17: 25,878,591 V253A probably damaging Het
Other mutations in Rpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Rpe APN 1 66706515 missense probably benign
R0507:Rpe UTSW 1 66715141 missense probably benign 0.04
R0742:Rpe UTSW 1 66715141 missense probably benign 0.04
R1808:Rpe UTSW 1 66715197 missense probably benign 0.26
R2118:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2119:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2120:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2122:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2126:Rpe UTSW 1 66715980 missense possibly damaging 0.95
R5549:Rpe UTSW 1 66716004 missense probably damaging 1.00
R5556:Rpe UTSW 1 66706466 missense probably damaging 1.00
R6238:Rpe UTSW 1 66701648 nonsense probably null
R6373:Rpe UTSW 1 66715980 missense probably benign 0.06
R8447:Rpe UTSW 1 66701029 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGAAGGCAGAAGCTCTGCAC -3'
(R):5'- AAGATCCTGAACACTGGAGGTGGC -3'

Sequencing Primer
(F):5'- AAGCTCTGCACCTGGCTC -3'
(R):5'- GGTCCTATCACCACAGGTTACG -3'
Posted On2014-04-13