Incidental Mutation 'R1545:Ppp2r1b'
ID172118
Institutional Source Beutler Lab
Gene Symbol Ppp2r1b
Ensembl Gene ENSMUSG00000032058
Gene Nameprotein phosphatase 2, regulatory subunit A, beta
Synonyms2410091N08Rik
MMRRC Submission 039584-MU
Accession Numbers

Ncbi RefSeq: NM_001034085.1, NM_028614.2; MGI:1920949

Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R1545 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location50845301-50894229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50862425 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 136 (K136R)
Ref Sequence ENSEMBL: ENSMUSP00000135758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000114437] [ENSMUST00000174628] [ENSMUST00000175640] [ENSMUST00000175645] [ENSMUST00000175926] [ENSMUST00000176349] [ENSMUST00000176798]
Predicted Effect probably benign
Transcript: ENSMUST00000034560
AA Change: K200R

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058
AA Change: K200R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114437
AA Change: K200R

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110080
Gene: ENSMUSG00000032058
AA Change: K200R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 1.6e-6 PFAM
Pfam:HEAT_EZ 180 243 7.3e-6 PFAM
Pfam:HEAT 217 247 4.3e-5 PFAM
Pfam:HEAT 295 325 4.2e-6 PFAM
Pfam:HEAT_2 378 479 9e-11 PFAM
Pfam:HEAT_2 494 597 4.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174555
Predicted Effect possibly damaging
Transcript: ENSMUST00000174628
AA Change: K200R

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058
AA Change: K200R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175640
SMART Domains Protein: ENSMUSP00000134740
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 129 159 5.7e-5 PFAM
Pfam:HEAT 168 198 4e-6 PFAM
Pfam:HEAT_2 251 352 6.3e-11 PFAM
Pfam:HEAT_2 365 470 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175645
AA Change: K200R

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135871
Gene: ENSMUSG00000032058
AA Change: K200R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT_EZ 173 243 8e-6 PFAM
Pfam:HEAT 178 208 1.8e-6 PFAM
Pfam:HEAT 217 247 4.9e-5 PFAM
Pfam:HEAT 295 325 4.8e-6 PFAM
Pfam:HEAT_2 449 552 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175926
SMART Domains Protein: ENSMUSP00000134886
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
SCOP:d1b3ua_ 14 104 4e-15 SMART
PDB:3DW8|D 22 104 4e-45 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000176349
AA Change: K136R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058
AA Change: K136R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176798
AA Change: K200R

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058
AA Change: K200R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C A 5: 98,329,432 Q27K probably benign Het
Aaas C T 15: 102,339,206 R410H probably damaging Het
Abca2 T C 2: 25,442,358 C1468R probably benign Het
Actl9 T A 17: 33,433,257 I97N probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asb3 T A 11: 31,056,217 M234K probably benign Het
Bax A C 7: 45,461,933 H168Q probably null Het
Brinp1 A G 4: 68,762,955 L446P possibly damaging Het
Cdc14a A G 3: 116,293,724 probably null Het
Cpq A T 15: 33,250,000 I168F probably damaging Het
Crkl A T 16: 17,483,692 N270I probably damaging Het
Cul7 G A 17: 46,651,553 E37K probably damaging Het
Eps15 C T 4: 109,312,329 T112I probably benign Het
F5 C T 1: 164,208,960 R1897* probably null Het
Fam160a1 C T 3: 85,665,954 S896N probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Gm884 T C 11: 103,608,919 K615E probably benign Het
Gprc5a C A 6: 135,083,461 T316K probably damaging Het
Hectd4 T A 5: 121,323,956 L2299Q possibly damaging Het
Khdc3 C G 9: 73,103,660 P240R probably benign Het
Kif20b A G 19: 34,928,918 T69A probably damaging Het
Kptn C G 7: 16,123,963 Q239E probably benign Het
Lep T C 6: 29,070,832 S52P probably damaging Het
Lrig3 G A 10: 126,008,547 V627M possibly damaging Het
Mdga1 G A 17: 29,842,902 R792C probably damaging Het
Mink1 T C 11: 70,598,891 V58A possibly damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nrg3 T A 14: 38,407,154 I375F probably benign Het
Nup50 A G 15: 84,939,792 T449A possibly damaging Het
Nup98 A G 7: 102,134,880 S1082P possibly damaging Het
Olfr904 C A 9: 38,464,519 H159Q probably benign Het
Otub1 T C 19: 7,199,206 I188V probably benign Het
Pcdhac2 T C 18: 37,146,133 I722T possibly damaging Het
Pcsk7 T A 9: 45,914,348 D292E probably damaging Het
Peli2 T A 14: 48,252,717 D215E probably benign Het
Ppp1r9a T C 6: 5,156,242 probably null Het
Prpf3 T C 3: 95,847,803 K157E probably damaging Het
Prss50 T C 9: 110,861,268 S160P probably damaging Het
Ptprb T C 10: 116,380,869 V2251A probably damaging Het
Rgs6 G A 12: 83,116,177 E386K probably damaging Het
Rida A G 15: 34,495,104 I5T probably benign Het
Rpe A G 1: 66,701,010 H35R probably damaging Het
Sema4b T A 7: 80,219,023 D321E probably benign Het
Slc22a13 G A 9: 119,209,047 A5V probably benign Het
Snta1 C T 2: 154,377,006 probably null Het
Spdye4c T A 2: 128,595,712 N220K probably benign Het
Sult1c1 G T 17: 53,962,148 A280E possibly damaging Het
Tfr2 A G 5: 137,583,299 E579G probably benign Het
Tmem221 A G 8: 71,558,538 L91P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Vmn1r17 A G 6: 57,361,332 V16A probably benign Het
Vmn1r188 A G 13: 22,088,433 R186G probably damaging Het
Wfikkn1 A G 17: 25,878,591 V253A probably damaging Het
Other mutations in Ppp2r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL01623:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL02120:Ppp2r1b APN 9 50861769 splice site probably benign
IGL02158:Ppp2r1b APN 9 50861609 missense probably benign 0.02
IGL02706:Ppp2r1b APN 9 50878834 missense possibly damaging 0.83
IGL02801:Ppp2r1b APN 9 50878827 missense probably benign 0.00
IGL02943:Ppp2r1b APN 9 50883585 missense probably damaging 1.00
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0211:Ppp2r1b UTSW 9 50861625 missense probably benign 0.00
R0603:Ppp2r1b UTSW 9 50861685 missense probably damaging 1.00
R1219:Ppp2r1b UTSW 9 50867321 splice site probably benign
R1513:Ppp2r1b UTSW 9 50870145 missense probably damaging 1.00
R1997:Ppp2r1b UTSW 9 50867371 missense possibly damaging 0.71
R1998:Ppp2r1b UTSW 9 50883585 missense probably damaging 1.00
R2153:Ppp2r1b UTSW 9 50866554 missense probably damaging 1.00
R3829:Ppp2r1b UTSW 9 50862494 missense probably benign 0.02
R4672:Ppp2r1b UTSW 9 50867719 missense probably damaging 0.99
R5299:Ppp2r1b UTSW 9 50857040 missense probably benign 0.04
R5376:Ppp2r1b UTSW 9 50866928 missense possibly damaging 0.78
R5504:Ppp2r1b UTSW 9 50858887 missense probably damaging 1.00
R5700:Ppp2r1b UTSW 9 50878157 missense probably damaging 1.00
R5771:Ppp2r1b UTSW 9 50866832 missense probably damaging 0.98
R7547:Ppp2r1b UTSW 9 50862462 missense probably benign 0.06
R7626:Ppp2r1b UTSW 9 50878176 missense possibly damaging 0.91
Z1088:Ppp2r1b UTSW 9 50866911 missense probably damaging 1.00
Z1176:Ppp2r1b UTSW 9 50873645 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGTGGGGTTGATGACACTTTTCC -3'
(R):5'- CCCTCTGAGCACAAAGAAACGTGG -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- ACGTGGGGCCTAGCTAAG -3'
Posted On2014-04-13