Incidental Mutation 'R1545:Nup50'
ID172137
Institutional Source Beutler Lab
Gene Symbol Nup50
Ensembl Gene ENSMUSG00000016619
Gene Namenucleoporin 50
Synonyms1700030K07Rik, Npap60
MMRRC Submission 039584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1545 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84923411-84942963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84939792 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 449 (T449A)
Ref Sequence ENSEMBL: ENSMUSP00000155656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047144] [ENSMUST00000165443] [ENSMUST00000230411]
Predicted Effect probably benign
Transcript: ENSMUST00000047144
SMART Domains Protein: ENSMUSP00000037011
Gene: ENSMUSG00000036046

DomainStartEndE-ValueType
Pfam:DUF2045 25 264 7.4e-123 PFAM
low complexity region 347 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165443
AA Change: T449A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131457
Gene: ENSMUSG00000016619
AA Change: T449A

DomainStartEndE-ValueType
Pfam:NUP50 2 80 1.2e-22 PFAM
low complexity region 277 302 N/A INTRINSIC
RanBD 340 463 4.83e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230411
AA Change: T449A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins that functions as a soluble cofactor in importin-alpha:beta-mediated nuclear protein import. Pseudogenes of this gene are found on chromosomes 5, 6, and 14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die perinatally, displaying neural tube defects, exencephaly, and intrauterine growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C A 5: 98,329,432 Q27K probably benign Het
Aaas C T 15: 102,339,206 R410H probably damaging Het
Abca2 T C 2: 25,442,358 C1468R probably benign Het
Actl9 T A 17: 33,433,257 I97N probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asb3 T A 11: 31,056,217 M234K probably benign Het
Bax A C 7: 45,461,933 H168Q probably null Het
Brinp1 A G 4: 68,762,955 L446P possibly damaging Het
Cdc14a A G 3: 116,293,724 probably null Het
Cpq A T 15: 33,250,000 I168F probably damaging Het
Crkl A T 16: 17,483,692 N270I probably damaging Het
Cul7 G A 17: 46,651,553 E37K probably damaging Het
Eps15 C T 4: 109,312,329 T112I probably benign Het
F5 C T 1: 164,208,960 R1897* probably null Het
Fam160a1 C T 3: 85,665,954 S896N probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Gm884 T C 11: 103,608,919 K615E probably benign Het
Gprc5a C A 6: 135,083,461 T316K probably damaging Het
Hectd4 T A 5: 121,323,956 L2299Q possibly damaging Het
Khdc3 C G 9: 73,103,660 P240R probably benign Het
Kif20b A G 19: 34,928,918 T69A probably damaging Het
Kptn C G 7: 16,123,963 Q239E probably benign Het
Lep T C 6: 29,070,832 S52P probably damaging Het
Lrig3 G A 10: 126,008,547 V627M possibly damaging Het
Mdga1 G A 17: 29,842,902 R792C probably damaging Het
Mink1 T C 11: 70,598,891 V58A possibly damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nrg3 T A 14: 38,407,154 I375F probably benign Het
Nup98 A G 7: 102,134,880 S1082P possibly damaging Het
Olfr904 C A 9: 38,464,519 H159Q probably benign Het
Otub1 T C 19: 7,199,206 I188V probably benign Het
Pcdhac2 T C 18: 37,146,133 I722T possibly damaging Het
Pcsk7 T A 9: 45,914,348 D292E probably damaging Het
Peli2 T A 14: 48,252,717 D215E probably benign Het
Ppp1r9a T C 6: 5,156,242 probably null Het
Ppp2r1b A G 9: 50,862,425 K136R possibly damaging Het
Prpf3 T C 3: 95,847,803 K157E probably damaging Het
Prss50 T C 9: 110,861,268 S160P probably damaging Het
Ptprb T C 10: 116,380,869 V2251A probably damaging Het
Rgs6 G A 12: 83,116,177 E386K probably damaging Het
Rida A G 15: 34,495,104 I5T probably benign Het
Rpe A G 1: 66,701,010 H35R probably damaging Het
Sema4b T A 7: 80,219,023 D321E probably benign Het
Slc22a13 G A 9: 119,209,047 A5V probably benign Het
Snta1 C T 2: 154,377,006 probably null Het
Spdye4c T A 2: 128,595,712 N220K probably benign Het
Sult1c1 G T 17: 53,962,148 A280E possibly damaging Het
Tfr2 A G 5: 137,583,299 E579G probably benign Het
Tmem221 A G 8: 71,558,538 L91P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Vmn1r17 A G 6: 57,361,332 V16A probably benign Het
Vmn1r188 A G 13: 22,088,433 R186G probably damaging Het
Wfikkn1 A G 17: 25,878,591 V253A probably damaging Het
Other mutations in Nup50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Nup50 APN 15 84935404 missense probably benign 0.33
IGL00939:Nup50 APN 15 84938420 nonsense probably null
R1483:Nup50 UTSW 15 84939727 missense probably damaging 1.00
R2504:Nup50 UTSW 15 84933658 missense probably benign 0.00
R3005:Nup50 UTSW 15 84929460 splice site probably null
R3690:Nup50 UTSW 15 84939793 missense probably damaging 1.00
R4851:Nup50 UTSW 15 84939711 missense probably benign 0.03
R5902:Nup50 UTSW 15 84935440 missense probably benign 0.00
R7205:Nup50 UTSW 15 84933658 missense probably benign 0.00
R8350:Nup50 UTSW 15 84935275 missense probably benign 0.01
R8450:Nup50 UTSW 15 84935275 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGATTGACTCCTAGCCTCTTACGG -3'
(R):5'- TGAGGGAGCCTTTGGAGAGCTAAC -3'

Sequencing Primer
(F):5'- TAGCCTCTTACGGAATCCTACAG -3'
(R):5'- GACACACTGAAAGGATTTATTGGC -3'
Posted On2014-04-13