Incidental Mutation 'R1546:Ctsl'
Institutional Source Beutler Lab
Gene Symbol Ctsl
Ensembl Gene ENSMUSG00000021477
Gene Namecathepsin L
Synonymsmajor excreted protein, 1190035F06Rik, Cat L, MEP
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosomal Location64359337-64370890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64367879 bp
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000152169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]
Predicted Effect probably damaging
Transcript: ENSMUST00000021933
AA Change: V126A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: V126A

signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220617
Predicted Effect probably damaging
Transcript: ENSMUST00000220737
AA Change: V126A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221233
Predicted Effect probably damaging
Transcript: ENSMUST00000222462
AA Change: V126A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222517
AA Change: V126A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222971
Predicted Effect probably benign
Transcript: ENSMUST00000223494
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Ctsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64368168 missense probably damaging 1.00
IGL02895:Ctsl APN 13 64366512 missense probably damaging 0.97
mauvais UTSW 13 64364102 unclassified probably null
patch UTSW 13 64366623 nonsense probably null
R0518:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R2096:Ctsl UTSW 13 64369026 critical splice donor site probably null
R5690:Ctsl UTSW 13 64365208 missense probably damaging 1.00
R5804:Ctsl UTSW 13 64366488 missense probably damaging 1.00
R6182:Ctsl UTSW 13 64367972 missense probably damaging 0.99
R6670:Ctsl UTSW 13 64364102 unclassified probably null
R6725:Ctsl UTSW 13 64366623 nonsense probably null
R6886:Ctsl UTSW 13 64365147 utr 3 prime probably null
R7502:Ctsl UTSW 13 64367068 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaggctaaagcacagaggac -3'
Posted On2014-04-13