Incidental Mutation 'R1547:Cdc42bpa'
ID172233
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180074644 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 489 (I489F)
Ref Sequence ENSEMBL: ENSMUSP00000095062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]
Predicted Effect probably damaging
Transcript: ENSMUST00000076687
AA Change: I489F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: I489F

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097450
AA Change: I489F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: I489F

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097453
AA Change: I489F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: I489F

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111117
AA Change: I489F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: I489F

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134959
SMART Domains Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
PDB:4AW2|A 2 90 1e-58 PDB
SCOP:d1koba_ 50 90 7e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212756
AA Change: I489F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAATAGCCATTCCTGTTCCATTTC -3'
(R):5'- GCCCCTCCTTCTGTAAGGCAATTACAT -3'

Sequencing Primer
(F):5'- gaaaaagaagagtagacagcagg -3'
(R):5'- CTTTCCAGATCAAATTATGAAACCAG -3'
Posted On2014-04-13