Incidental Mutation 'R1547:Fmnl2'
ID172237
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Nameformin-like 2
Synonyms5430425K04Rik, man
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location52857860-53133804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53105537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 424 (E424G)
Ref Sequence ENSEMBL: ENSMUSP00000117822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049483
AA Change: E424G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: E424G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050719
AA Change: E424G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: E424G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090952
AA Change: E424G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: E424G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127122
AA Change: E424G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: E424G

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155586
AA Change: E424G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: E424G

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Meta Mutation Damage Score 0.6222 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
PIT4280001:Fmnl2 UTSW 2 53118196 missense unknown
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1615:Fmnl2 UTSW 2 53118424 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4095:Fmnl2 UTSW 2 53101523 missense probably damaging 0.99
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4608:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5015:Fmnl2 UTSW 2 53103761 missense possibly damaging 0.85
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 intron probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
R7006:Fmnl2 UTSW 2 53108254 missense probably benign 0.27
R7146:Fmnl2 UTSW 2 53068540 missense
R7173:Fmnl2 UTSW 2 53114190 missense unknown
R7176:Fmnl2 UTSW 2 53114150 missense unknown
R7182:Fmnl2 UTSW 2 53107441 missense unknown
R7201:Fmnl2 UTSW 2 53073654 missense unknown
R7470:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R7481:Fmnl2 UTSW 2 53108431 missense unknown
R7691:Fmnl2 UTSW 2 53101498 missense unknown
R7699:Fmnl2 UTSW 2 53036508 missense
R7700:Fmnl2 UTSW 2 53036508 missense
R7722:Fmnl2 UTSW 2 53054467 missense
Predicted Primers PCR Primer
(F):5'- TGTTCACCGAATGGCTGCTGTATG -3'
(R):5'- AGGGTCACCAGTGAAATGGTTGC -3'

Sequencing Primer
(F):5'- CTTCTGGACTATATGCAAGACTCTG -3'
(R):5'- TGGTTGCACTAAATACACGGC -3'
Posted On2014-04-13